Incidental Mutation 'R0562:Tns3'
ID45962
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 038753-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R0562 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8493262 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 367 (I367N)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: I367N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: I367N

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,977,113 M120V probably benign Het
9530053A07Rik G A 7: 28,162,690 V2394I probably benign Het
Acadsb C T 7: 131,425,789 Q63* probably null Het
Adam26b A T 8: 43,520,371 N531K probably benign Het
Agt A G 8: 124,559,275 I356T probably benign Het
Ankmy1 A T 1: 92,899,691 probably benign Het
Anxa3 C T 5: 96,812,884 S49L possibly damaging Het
Arap3 C A 18: 37,975,540 R1279L probably damaging Het
Azin1 A G 15: 38,493,581 I266T probably benign Het
Btnl7-ps T C 17: 34,533,524 noncoding transcript Het
Car5a T A 8: 121,944,730 T22S probably benign Het
Card6 A G 15: 5,105,166 I185T probably damaging Het
Ccdc81 T C 7: 89,903,229 D11G probably benign Het
Cep170b T C 12: 112,739,189 V1127A probably benign Het
Ces1h T C 8: 93,357,143 I390M unknown Het
Col9a1 T A 1: 24,179,279 probably null Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Cyb561a3 T C 19: 10,586,710 V138A probably benign Het
Dcaf1 T C 9: 106,844,122 probably benign Het
Dnah17 A G 11: 118,072,900 Y2516H probably damaging Het
Dsc2 T A 18: 20,041,537 N521Y probably damaging Het
Dst G A 1: 34,227,981 E4835K probably damaging Het
Duox2 T C 2: 122,289,599 E810G probably damaging Het
Dusp15 T C 2: 152,951,348 N3S possibly damaging Het
Epha4 T C 1: 77,388,487 K625R probably benign Het
Gata5 C T 2: 180,327,759 probably null Het
Gm10264 A G 12: 88,329,666 D138G unknown Het
Gm14139 T A 2: 150,192,574 C303S probably damaging Het
Grm5 A G 7: 87,603,019 N159S probably damaging Het
Hivep3 T A 4: 120,096,554 M689K probably benign Het
Ilvbl G T 10: 78,583,487 G499C probably damaging Het
Inpp4b T C 8: 81,768,151 I65T possibly damaging Het
Jarid2 T C 13: 44,902,359 V208A probably damaging Het
Kcnh4 T C 11: 100,750,244 M460V possibly damaging Het
Klhl22 A G 16: 17,792,624 N580D probably benign Het
Klk15 T A 7: 43,938,845 C192* probably null Het
Klk9 A G 7: 43,795,666 E194G probably damaging Het
Lama1 G T 17: 67,815,959 G2779V probably damaging Het
Lmln C T 16: 33,117,085 R607* probably null Het
Maea T C 5: 33,372,301 V377A probably benign Het
Matk A T 10: 81,259,691 Y115F probably benign Het
Mettl18 A G 1: 163,996,493 K128E probably benign Het
Mrps22 T C 9: 98,592,693 H246R probably benign Het
Msln A T 17: 25,753,006 M79K probably benign Het
Myf6 G A 10: 107,494,559 P49L probably benign Het
Nat1 C T 8: 67,491,311 T113I possibly damaging Het
Ncor2 C T 5: 125,085,029 V394M unknown Het
Oas1c T C 5: 120,805,604 probably benign Het
Olfr1053 T A 2: 86,314,525 T254S probably benign Het
Otp A T 13: 94,877,409 T112S probably damaging Het
Pcdh7 A G 5: 57,720,063 N320S probably damaging Het
Pdzd2 G T 15: 12,592,278 F93L probably damaging Het
Phf20l1 A G 15: 66,609,604 E283G probably damaging Het
Polr1e T C 4: 45,029,421 F342S probably damaging Het
Pp2d1 T A 17: 53,539,168 probably benign Het
Ptpn13 T A 5: 103,516,425 probably null Het
Reg3g A T 6: 78,467,488 H107Q possibly damaging Het
Rgl1 T C 1: 152,539,945 K408E probably damaging Het
Samd4 T C 14: 47,077,509 C309R probably damaging Het
Sestd1 C A 2: 77,230,722 W104L probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc22a21 T A 11: 53,979,620 K80* probably null Het
Snx20 T A 8: 88,630,002 Q62L probably benign Het
Stk40 C A 4: 126,138,801 probably benign Het
Taf2 A T 15: 55,022,188 probably benign Het
Tcf23 C T 5: 30,970,310 P152L probably damaging Het
Tex29 T C 8: 11,844,138 probably benign Het
Tjp3 A G 10: 81,280,555 V235A probably damaging Het
Ttc26 T A 6: 38,401,129 V292E probably damaging Het
Ttn T A 2: 76,712,911 M33244L probably benign Het
Ush2a A T 1: 188,356,847 N333I probably damaging Het
Usp34 T C 11: 23,432,406 probably benign Het
Vmn1r204 A C 13: 22,556,678 S160R probably benign Het
Vmn2r75 C T 7: 86,148,241 W788* probably null Het
Vwa5b1 T C 4: 138,635,711 probably benign Het
Zbtb7a A G 10: 81,148,329 E535G probably benign Het
Zranb3 T C 1: 128,036,558 D144G probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
R8518:Tns3 UTSW 11 8492971 missense probably damaging 0.96
R8523:Tns3 UTSW 11 8448779 missense probably damaging 1.00
R8790:Tns3 UTSW 11 8518273 missense probably damaging 0.99
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGGCCAAATCCACTGAGC -3'
(R):5'- CTGCACTTGCGTACTATTGAGTTGC -3'

Sequencing Primer
(F):5'- CTGGTCCAGCTCAGCCTTC -3'
(R):5'- GAGTTGCATTATAGACCCACTCATC -3'
Posted On2013-06-11