Incidental Mutation 'R0562:Usp34'
ID45963
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Nameubiquitin specific peptidase 34
SynonymsMurr2, A530081C03Rik
MMRRC Submission 038753-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R0562 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23306895-23490560 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 23432406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
Predicted Effect probably benign
Transcript: ENSMUST00000130131
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137823
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,977,113 M120V probably benign Het
9530053A07Rik G A 7: 28,162,690 V2394I probably benign Het
Acadsb C T 7: 131,425,789 Q63* probably null Het
Adam26b A T 8: 43,520,371 N531K probably benign Het
Agt A G 8: 124,559,275 I356T probably benign Het
Ankmy1 A T 1: 92,899,691 probably benign Het
Anxa3 C T 5: 96,812,884 S49L possibly damaging Het
Arap3 C A 18: 37,975,540 R1279L probably damaging Het
Azin1 A G 15: 38,493,581 I266T probably benign Het
Btnl7-ps T C 17: 34,533,524 noncoding transcript Het
Car5a T A 8: 121,944,730 T22S probably benign Het
Card6 A G 15: 5,105,166 I185T probably damaging Het
Ccdc81 T C 7: 89,903,229 D11G probably benign Het
Cep170b T C 12: 112,739,189 V1127A probably benign Het
Ces1h T C 8: 93,357,143 I390M unknown Het
Col9a1 T A 1: 24,179,279 probably null Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Cyb561a3 T C 19: 10,586,710 V138A probably benign Het
Dcaf1 T C 9: 106,844,122 probably benign Het
Dnah17 A G 11: 118,072,900 Y2516H probably damaging Het
Dsc2 T A 18: 20,041,537 N521Y probably damaging Het
Dst G A 1: 34,227,981 E4835K probably damaging Het
Duox2 T C 2: 122,289,599 E810G probably damaging Het
Dusp15 T C 2: 152,951,348 N3S possibly damaging Het
Epha4 T C 1: 77,388,487 K625R probably benign Het
Gata5 C T 2: 180,327,759 probably null Het
Gm10264 A G 12: 88,329,666 D138G unknown Het
Gm14139 T A 2: 150,192,574 C303S probably damaging Het
Grm5 A G 7: 87,603,019 N159S probably damaging Het
Hivep3 T A 4: 120,096,554 M689K probably benign Het
Ilvbl G T 10: 78,583,487 G499C probably damaging Het
Inpp4b T C 8: 81,768,151 I65T possibly damaging Het
Jarid2 T C 13: 44,902,359 V208A probably damaging Het
Kcnh4 T C 11: 100,750,244 M460V possibly damaging Het
Klhl22 A G 16: 17,792,624 N580D probably benign Het
Klk15 T A 7: 43,938,845 C192* probably null Het
Klk9 A G 7: 43,795,666 E194G probably damaging Het
Lama1 G T 17: 67,815,959 G2779V probably damaging Het
Lmln C T 16: 33,117,085 R607* probably null Het
Maea T C 5: 33,372,301 V377A probably benign Het
Matk A T 10: 81,259,691 Y115F probably benign Het
Mettl18 A G 1: 163,996,493 K128E probably benign Het
Mrps22 T C 9: 98,592,693 H246R probably benign Het
Msln A T 17: 25,753,006 M79K probably benign Het
Myf6 G A 10: 107,494,559 P49L probably benign Het
Nat1 C T 8: 67,491,311 T113I possibly damaging Het
Ncor2 C T 5: 125,085,029 V394M unknown Het
Oas1c T C 5: 120,805,604 probably benign Het
Olfr1053 T A 2: 86,314,525 T254S probably benign Het
Otp A T 13: 94,877,409 T112S probably damaging Het
Pcdh7 A G 5: 57,720,063 N320S probably damaging Het
Pdzd2 G T 15: 12,592,278 F93L probably damaging Het
Phf20l1 A G 15: 66,609,604 E283G probably damaging Het
Polr1e T C 4: 45,029,421 F342S probably damaging Het
Pp2d1 T A 17: 53,539,168 probably benign Het
Ptpn13 T A 5: 103,516,425 probably null Het
Reg3g A T 6: 78,467,488 H107Q possibly damaging Het
Rgl1 T C 1: 152,539,945 K408E probably damaging Het
Samd4 T C 14: 47,077,509 C309R probably damaging Het
Sestd1 C A 2: 77,230,722 W104L probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc22a21 T A 11: 53,979,620 K80* probably null Het
Snx20 T A 8: 88,630,002 Q62L probably benign Het
Stk40 C A 4: 126,138,801 probably benign Het
Taf2 A T 15: 55,022,188 probably benign Het
Tcf23 C T 5: 30,970,310 P152L probably damaging Het
Tex29 T C 8: 11,844,138 probably benign Het
Tjp3 A G 10: 81,280,555 V235A probably damaging Het
Tns3 A T 11: 8,493,262 I367N possibly damaging Het
Ttc26 T A 6: 38,401,129 V292E probably damaging Het
Ttn T A 2: 76,712,911 M33244L probably benign Het
Ush2a A T 1: 188,356,847 N333I probably damaging Het
Vmn1r204 A C 13: 22,556,678 S160R probably benign Het
Vmn2r75 C T 7: 86,148,241 W788* probably null Het
Vwa5b1 T C 4: 138,635,711 probably benign Het
Zbtb7a A G 10: 81,148,329 E535G probably benign Het
Zranb3 T C 1: 128,036,558 D144G probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAGCGACATGGCATTTTCCAC -3'
(R):5'- TATCTGCCACCTGGCACCTCACAG -3'

Sequencing Primer
(F):5'- GGCATTTTCCACCCCATATGATTG -3'
(R):5'- GTTCACAATCCTGGATGATCAAC -3'
Posted On2013-06-11