Incidental Mutation 'R0562:Lmln'
ID45981
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Nameleishmanolysin-like (metallopeptidase M8 family)
Synonyms5330415H22Rik
MMRRC Submission 038753-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0562 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33062521-33127695 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 33117085 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 607 (R607*)
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497]
Predicted Effect probably null
Transcript: ENSMUST00000023497
AA Change: R607*
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802
AA Change: R607*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140504
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,977,113 M120V probably benign Het
9530053A07Rik G A 7: 28,162,690 V2394I probably benign Het
Acadsb C T 7: 131,425,789 Q63* probably null Het
Adam26b A T 8: 43,520,371 N531K probably benign Het
Agt A G 8: 124,559,275 I356T probably benign Het
Ankmy1 A T 1: 92,899,691 probably benign Het
Anxa3 C T 5: 96,812,884 S49L possibly damaging Het
Arap3 C A 18: 37,975,540 R1279L probably damaging Het
Azin1 A G 15: 38,493,581 I266T probably benign Het
Btnl7-ps T C 17: 34,533,524 noncoding transcript Het
Car5a T A 8: 121,944,730 T22S probably benign Het
Card6 A G 15: 5,105,166 I185T probably damaging Het
Ccdc81 T C 7: 89,903,229 D11G probably benign Het
Cep170b T C 12: 112,739,189 V1127A probably benign Het
Ces1h T C 8: 93,357,143 I390M unknown Het
Col9a1 T A 1: 24,179,279 probably null Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Cyb561a3 T C 19: 10,586,710 V138A probably benign Het
Dcaf1 T C 9: 106,844,122 probably benign Het
Dnah17 A G 11: 118,072,900 Y2516H probably damaging Het
Dsc2 T A 18: 20,041,537 N521Y probably damaging Het
Dst G A 1: 34,227,981 E4835K probably damaging Het
Duox2 T C 2: 122,289,599 E810G probably damaging Het
Dusp15 T C 2: 152,951,348 N3S possibly damaging Het
Epha4 T C 1: 77,388,487 K625R probably benign Het
Gata5 C T 2: 180,327,759 probably null Het
Gm10264 A G 12: 88,329,666 D138G unknown Het
Gm14139 T A 2: 150,192,574 C303S probably damaging Het
Grm5 A G 7: 87,603,019 N159S probably damaging Het
Hivep3 T A 4: 120,096,554 M689K probably benign Het
Ilvbl G T 10: 78,583,487 G499C probably damaging Het
Inpp4b T C 8: 81,768,151 I65T possibly damaging Het
Jarid2 T C 13: 44,902,359 V208A probably damaging Het
Kcnh4 T C 11: 100,750,244 M460V possibly damaging Het
Klhl22 A G 16: 17,792,624 N580D probably benign Het
Klk15 T A 7: 43,938,845 C192* probably null Het
Klk9 A G 7: 43,795,666 E194G probably damaging Het
Lama1 G T 17: 67,815,959 G2779V probably damaging Het
Maea T C 5: 33,372,301 V377A probably benign Het
Matk A T 10: 81,259,691 Y115F probably benign Het
Mettl18 A G 1: 163,996,493 K128E probably benign Het
Mrps22 T C 9: 98,592,693 H246R probably benign Het
Msln A T 17: 25,753,006 M79K probably benign Het
Myf6 G A 10: 107,494,559 P49L probably benign Het
Nat1 C T 8: 67,491,311 T113I possibly damaging Het
Ncor2 C T 5: 125,085,029 V394M unknown Het
Oas1c T C 5: 120,805,604 probably benign Het
Olfr1053 T A 2: 86,314,525 T254S probably benign Het
Otp A T 13: 94,877,409 T112S probably damaging Het
Pcdh7 A G 5: 57,720,063 N320S probably damaging Het
Pdzd2 G T 15: 12,592,278 F93L probably damaging Het
Phf20l1 A G 15: 66,609,604 E283G probably damaging Het
Polr1e T C 4: 45,029,421 F342S probably damaging Het
Pp2d1 T A 17: 53,539,168 probably benign Het
Ptpn13 T A 5: 103,516,425 probably null Het
Reg3g A T 6: 78,467,488 H107Q possibly damaging Het
Rgl1 T C 1: 152,539,945 K408E probably damaging Het
Samd4 T C 14: 47,077,509 C309R probably damaging Het
Sestd1 C A 2: 77,230,722 W104L probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc22a21 T A 11: 53,979,620 K80* probably null Het
Snx20 T A 8: 88,630,002 Q62L probably benign Het
Stk40 C A 4: 126,138,801 probably benign Het
Taf2 A T 15: 55,022,188 probably benign Het
Tcf23 C T 5: 30,970,310 P152L probably damaging Het
Tex29 T C 8: 11,844,138 probably benign Het
Tjp3 A G 10: 81,280,555 V235A probably damaging Het
Tns3 A T 11: 8,493,262 I367N possibly damaging Het
Ttc26 T A 6: 38,401,129 V292E probably damaging Het
Ttn T A 2: 76,712,911 M33244L probably benign Het
Ush2a A T 1: 188,356,847 N333I probably damaging Het
Usp34 T C 11: 23,432,406 probably benign Het
Vmn1r204 A C 13: 22,556,678 S160R probably benign Het
Vmn2r75 C T 7: 86,148,241 W788* probably null Het
Vwa5b1 T C 4: 138,635,711 probably benign Het
Zbtb7a A G 10: 81,148,329 E535G probably benign Het
Zranb3 T C 1: 128,036,558 D144G probably benign Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 33083065 missense probably benign 0.08
IGL01346:Lmln APN 16 33117120 missense probably benign 0.00
IGL01664:Lmln APN 16 33080987 missense probably benign 0.03
nemeth UTSW 16 33074097 nonsense probably null
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R0234:Lmln UTSW 16 33066324 missense probably damaging 0.99
R1017:Lmln UTSW 16 33088176 missense probably benign
R1557:Lmln UTSW 16 33088211 missense probably benign 0.25
R1617:Lmln UTSW 16 33117130 missense probably damaging 1.00
R2211:Lmln UTSW 16 33109778 missense probably benign 0.00
R4061:Lmln UTSW 16 33066391 nonsense probably null
R4414:Lmln UTSW 16 33109850 missense probably benign 0.00
R4512:Lmln UTSW 16 33088137 missense probably benign 0.01
R4564:Lmln UTSW 16 33109856 missense probably benign 0.09
R4995:Lmln UTSW 16 33074097 nonsense probably null
R5044:Lmln UTSW 16 33074180 missense possibly damaging 0.80
R6109:Lmln UTSW 16 33069111 missense possibly damaging 0.69
R6287:Lmln UTSW 16 33074185 critical splice donor site probably null
R6577:Lmln UTSW 16 33107000 splice site probably null
R6689:Lmln UTSW 16 33104782 missense probably benign 0.19
R7079:Lmln UTSW 16 33067291 missense probably benign 0.02
R7432:Lmln UTSW 16 33089368 missense probably damaging 1.00
R7807:Lmln UTSW 16 33107131 missense probably benign 0.04
R8185:Lmln UTSW 16 33089320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCCATACTGTGCTTGATTTGAAAC -3'
(R):5'- GCAGGAAGCAGGATTTTCTTAGCCTC -3'

Sequencing Primer
(F):5'- cgcctgtgtgtgaagcc -3'
(R):5'- GCCCTGCTAAAGGGCATTTC -3'
Posted On2013-06-11