Incidental Mutation 'R5055:Pde3a'
ID459851
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission 042645-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R5055 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 141487956 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 855 (Q855*)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably null
Transcript: ENSMUST00000043259
AA Change: Q855*
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: Q855*

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 G A 11: 46,123,169 V329I probably damaging Het
Adgrl3 C A 5: 81,646,551 A541E possibly damaging Het
Agbl1 A T 7: 76,413,577 I263F probably damaging Het
Ash1l T C 3: 89,023,212 probably null Het
BC051142 G A 17: 34,448,796 C154Y possibly damaging Het
Bccip A G 7: 133,714,923 T91A probably benign Het
Bnc1 A T 7: 81,974,415 F355I probably damaging Het
Bpifa2 A T 2: 154,013,710 D185V probably damaging Het
Capn8 T A 1: 182,571,961 V89D probably damaging Het
Cfap46 A T 7: 139,661,190 M421K probably damaging Het
Chd2 A T 7: 73,480,508 L800M probably damaging Het
Chd4 A G 6: 125,100,986 D137G possibly damaging Het
Crtap A G 9: 114,390,140 Y154H probably benign Het
Ctdp1 T A 18: 80,456,088 Q213L probably damaging Het
Cts6 T C 13: 61,196,350 Y296C probably damaging Het
Daxx G T 17: 33,912,160 V354F probably benign Het
Dnah2 A G 11: 69,520,773 I341T possibly damaging Het
Epha2 A G 4: 141,309,069 D272G probably benign Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fbxl7 C A 15: 26,552,936 G82W probably damaging Het
Fcamr G A 1: 130,811,437 C158Y probably damaging Het
Fyb A C 15: 6,585,149 probably benign Het
Gars G A 6: 55,068,092 R454H probably damaging Het
Ghsr T C 3: 27,372,272 V159A probably benign Het
Glp1r A T 17: 30,918,887 Q97H probably benign Het
Gm27047 T C 6: 130,629,946 noncoding transcript Het
Igkv3-3 A C 6: 70,687,239 I22L probably benign Het
Inpp5b G T 4: 124,743,031 probably null Het
Ipo9 C A 1: 135,402,359 E448* probably null Het
Itgb2l A T 16: 96,427,803 I400N probably damaging Het
Kat6b T A 14: 21,516,994 H40Q probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcnq2 G T 2: 181,086,761 probably benign Het
Klf7 T C 1: 64,079,280 T53A probably benign Het
Kmt2a A G 9: 44,818,352 probably benign Het
Lrp10 C T 14: 54,468,345 R331C probably benign Het
Map4k5 A T 12: 69,831,558 D289E probably benign Het
Mfsd4b2 A T 10: 39,923,777 M43K possibly damaging Het
Msr1 T G 8: 39,623,956 R138S possibly damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Myh9 G A 15: 77,764,523 A1711V probably benign Het
Myo18b A G 5: 112,875,217 probably benign Het
Nampt A T 12: 32,833,121 N102Y possibly damaging Het
Nell2 T C 15: 95,473,579 I92V probably benign Het
Nes A G 3: 87,977,214 N883D probably benign Het
Neurl3 T A 1: 36,273,382 probably benign Het
Ocln T A 13: 100,539,422 T188S probably benign Het
Olfr1023 T C 2: 85,887,241 F147S probably benign Het
Olfr704 T A 7: 106,865,730 M250K probably damaging Het
Parp14 T A 16: 35,844,363 Q1305L probably benign Het
Pde4b T C 4: 102,195,114 probably benign Het
Pdk2 T C 11: 95,039,416 M65V probably benign Het
Phf21a T C 2: 92,351,856 S377P probably damaging Het
Plcb2 T A 2: 118,718,222 T408S probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ppp6r2 A G 15: 89,282,949 D789G probably benign Het
Prdm16 T C 4: 154,335,262 M897V possibly damaging Het
Prss57 A G 10: 79,784,344 probably null Het
Psd G T 19: 46,322,468 L381I probably benign Het
Ptprq A T 10: 107,534,679 D2050E probably benign Het
Rfc1 G T 5: 65,266,162 N1034K probably damaging Het
Ryr3 C T 2: 112,831,159 G1829S probably benign Het
Scaper T C 9: 55,859,719 probably null Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Slc28a1 A G 7: 81,169,048 N583S possibly damaging Het
Slc35e3 C T 10: 117,744,979 G140D probably damaging Het
Slc6a9 G A 4: 117,868,150 probably null Het
Sptlc1 A G 13: 53,342,182 S376P probably benign Het
Sspo G A 6: 48,464,795 C1913Y probably damaging Het
Taar7b A T 10: 24,000,947 I337F possibly damaging Het
Tdpoz2 T A 3: 93,651,928 I246F probably damaging Het
Trpa1 C T 1: 14,875,959 V983M probably damaging Het
Trpm5 A T 7: 143,072,784 M1112K probably benign Het
Uso1 A T 5: 92,192,735 K670I probably benign Het
Washc4 A G 10: 83,556,907 D257G probably damaging Het
Wdr41 T A 13: 95,015,217 probably null Het
Zbtb17 A G 4: 141,466,549 Q668R possibly damaging Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141492310 missense probably benign 0.04
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141487513 missense probably damaging 1.00
R1902:Pde3a UTSW 6 141498770 missense probably benign
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5181:Pde3a UTSW 6 141481255 critical splice donor site probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141487511 missense probably damaging 1.00
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense probably benign 0.26
R7163:Pde3a UTSW 6 141487544 missense probably damaging 1.00
R7677:Pde3a UTSW 6 141250257 missense probably damaging 1.00
R7754:Pde3a UTSW 6 141459249 missense probably benign 0.32
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATTTACACACGGACACATG -3'
(R):5'- GGCAACTGAGAAAAGACCTTTG -3'

Sequencing Primer
(F):5'- TTTACACACGGACACATGGGATATG -3'
(R):5'- AATATCTATCATGATTGTCTTGGCAC -3'
Posted On2017-02-27