Incidental Mutation 'R5058:Poc1a'
ID459859
Institutional Source Beutler Lab
Gene Symbol Poc1a
Ensembl Gene ENSMUSG00000023345
Gene NamePOC1 centriolar protein A
SynonymsWdr51a, 2510040D07Rik
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R5058 (G1)
Quality Score77
Status Validated
Chromosome9
Chromosomal Location106281061-106350521 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to T at 106349813 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072206] [ENSMUST00000191434] [ENSMUST00000214540] [ENSMUST00000216228] [ENSMUST00000217213]
Predicted Effect probably benign
Transcript: ENSMUST00000072206
SMART Domains Protein: ENSMUSP00000072064
Gene: ENSMUSG00000023345

DomainStartEndE-ValueType
WD40 8 47 1.76e-9 SMART
WD40 50 89 5.51e-11 SMART
WD40 92 131 2.45e-8 SMART
WD40 134 173 5.14e-11 SMART
WD40 176 215 5.06e-10 SMART
WD40 218 257 9.97e-9 SMART
WD40 260 299 2.67e-9 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 367 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189325
Predicted Effect probably benign
Transcript: ENSMUST00000191434
SMART Domains Protein: ENSMUSP00000140374
Gene: ENSMUSG00000023345

DomainStartEndE-ValueType
WD40 7 46 1.76e-9 SMART
WD40 49 88 5.51e-11 SMART
WD40 91 130 2.45e-8 SMART
WD40 133 172 5.14e-11 SMART
WD40 175 214 5.06e-10 SMART
WD40 217 256 9.97e-9 SMART
WD40 259 298 2.67e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214208
Predicted Effect probably benign
Transcript: ENSMUST00000214483
Predicted Effect probably benign
Transcript: ENSMUST00000214540
Predicted Effect probably benign
Transcript: ENSMUST00000216228
Predicted Effect unknown
Transcript: ENSMUST00000216306
AA Change: G415W
Predicted Effect probably benign
Transcript: ENSMUST00000217213
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutations in this gene result in short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT) syndrome. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for this mutation exhibit disproportionate dwarfism and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Hyal5 T C 6: 24,891,485 F433L probably damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Poc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Poc1a APN 9 106305304 missense probably benign 0.27
IGL02792:Poc1a APN 9 106295194 missense possibly damaging 0.75
IGL02936:Poc1a APN 9 106285027 missense probably damaging 1.00
PIT4305001:Poc1a UTSW 9 106349829 missense
R2154:Poc1a UTSW 9 106285574 critical splice donor site probably null
R4658:Poc1a UTSW 9 106349688 missense possibly damaging 0.95
R4811:Poc1a UTSW 9 106349709 missense probably damaging 0.96
R5059:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5060:Poc1a UTSW 9 106349813 utr 3 prime probably benign
R5461:Poc1a UTSW 9 106288010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATACTGACTCCTAGGGCAGCG -3'
(R):5'- TTAAACTGCATGTGGCCCTG -3'

Sequencing Primer
(F):5'- AGCGAGGCAGGCTTTCCATC -3'
(R):5'- GGGTCTCCAGTCTCCTTTTTGTG -3'
Posted On2017-02-27