Mutagenetix > Incidental Mutation

Incidental Mutation 'R0562:Dsc2'

45986

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

038753-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0562 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20041537 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 521 (N521Y)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: N521Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: N521Y

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: N521Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: N521Y

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,977,113	M120V	probably benign	Het
9530053A07Rik	G	A	7: 28,162,690	V2394I	probably benign	Het
Acadsb	C	T	7: 131,425,789	Q63*	probably null	Het
Adam26b	A	T	8: 43,520,371	N531K	probably benign	Het
Agt	A	G	8: 124,559,275	I356T	probably benign	Het
Ankmy1	A	T	1: 92,899,691		probably benign	Het
Anxa3	C	T	5: 96,812,884	S49L	possibly damaging	Het
Arap3	C	A	18: 37,975,540	R1279L	probably damaging	Het
Azin1	A	G	15: 38,493,581	I266T	probably benign	Het
Btnl7-ps	T	C	17: 34,533,524		noncoding transcript	Het
Car5a	T	A	8: 121,944,730	T22S	probably benign	Het
Card6	A	G	15: 5,105,166	I185T	probably damaging	Het
Ccdc81	T	C	7: 89,903,229	D11G	probably benign	Het
Cep170b	T	C	12: 112,739,189	V1127A	probably benign	Het
Ces1h	T	C	8: 93,357,143	I390M	unknown	Het
Col9a1	T	A	1: 24,179,279		probably null	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
Cyb561a3	T	C	19: 10,586,710	V138A	probably benign	Het
Dcaf1	T	C	9: 106,844,122		probably benign	Het
Dnah17	A	G	11: 118,072,900	Y2516H	probably damaging	Het
Dst	G	A	1: 34,227,981	E4835K	probably damaging	Het
Duox2	T	C	2: 122,289,599	E810G	probably damaging	Het
Dusp15	T	C	2: 152,951,348	N3S	possibly damaging	Het
Epha4	T	C	1: 77,388,487	K625R	probably benign	Het
Gata5	C	T	2: 180,327,759		probably null	Het
Gm10264	A	G	12: 88,329,666	D138G	unknown	Het
Gm14139	T	A	2: 150,192,574	C303S	probably damaging	Het
Grm5	A	G	7: 87,603,019	N159S	probably damaging	Het
Hivep3	T	A	4: 120,096,554	M689K	probably benign	Het
Ilvbl	G	T	10: 78,583,487	G499C	probably damaging	Het
Inpp4b	T	C	8: 81,768,151	I65T	possibly damaging	Het
Jarid2	T	C	13: 44,902,359	V208A	probably damaging	Het
Kcnh4	T	C	11: 100,750,244	M460V	possibly damaging	Het
Klhl22	A	G	16: 17,792,624	N580D	probably benign	Het
Klk15	T	A	7: 43,938,845	C192*	probably null	Het
Klk9	A	G	7: 43,795,666	E194G	probably damaging	Het
Lama1	G	T	17: 67,815,959	G2779V	probably damaging	Het
Lmln	C	T	16: 33,117,085	R607*	probably null	Het
Maea	T	C	5: 33,372,301	V377A	probably benign	Het
Matk	A	T	10: 81,259,691	Y115F	probably benign	Het
Mettl18	A	G	1: 163,996,493	K128E	probably benign	Het
Mrps22	T	C	9: 98,592,693	H246R	probably benign	Het
Msln	A	T	17: 25,753,006	M79K	probably benign	Het
Myf6	G	A	10: 107,494,559	P49L	probably benign	Het
Nat1	C	T	8: 67,491,311	T113I	possibly damaging	Het
Ncor2	C	T	5: 125,085,029	V394M	unknown	Het
Oas1c	T	C	5: 120,805,604		probably benign	Het
Olfr1053	T	A	2: 86,314,525	T254S	probably benign	Het
Otp	A	T	13: 94,877,409	T112S	probably damaging	Het
Pcdh7	A	G	5: 57,720,063	N320S	probably damaging	Het
Pdzd2	G	T	15: 12,592,278	F93L	probably damaging	Het
Phf20l1	A	G	15: 66,609,604	E283G	probably damaging	Het
Polr1e	T	C	4: 45,029,421	F342S	probably damaging	Het
Pp2d1	T	A	17: 53,539,168		probably benign	Het
Ptpn13	T	A	5: 103,516,425		probably null	Het
Reg3g	A	T	6: 78,467,488	H107Q	possibly damaging	Het
Rgl1	T	C	1: 152,539,945	K408E	probably damaging	Het
Samd4	T	C	14: 47,077,509	C309R	probably damaging	Het
Sestd1	C	A	2: 77,230,722	W104L	probably benign	Het
Sfmbt1	T	A	14: 30,811,373		probably null	Het
Slc22a21	T	A	11: 53,979,620	K80*	probably null	Het
Snx20	T	A	8: 88,630,002	Q62L	probably benign	Het
Stk40	C	A	4: 126,138,801		probably benign	Het
Taf2	A	T	15: 55,022,188		probably benign	Het
Tcf23	C	T	5: 30,970,310	P152L	probably damaging	Het
Tex29	T	C	8: 11,844,138		probably benign	Het
Tjp3	A	G	10: 81,280,555	V235A	probably damaging	Het
Tns3	A	T	11: 8,493,262	I367N	possibly damaging	Het
Ttc26	T	A	6: 38,401,129	V292E	probably damaging	Het
Ttn	T	A	2: 76,712,911	M33244L	probably benign	Het
Ush2a	A	T	1: 188,356,847	N333I	probably damaging	Het
Usp34	T	C	11: 23,432,406		probably benign	Het
Vmn1r204	A	C	13: 22,556,678	S160R	probably benign	Het
Vmn2r75	C	T	7: 86,148,241	W788*	probably null	Het
Vwa5b1	T	C	4: 138,635,711		probably benign	Het
Zbtb7a	A	G	10: 81,148,329	E535G	probably benign	Het
Zranb3	T	C	1: 128,036,558	D144G	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACTGATCCAGAGCACCATGAC -3'
(R):5'- CCGAGTGTATCCCTCCAATGCAAAC -3'

Sequencing Primer
(F):5'- GAGCACCATGACATTCAAAATATG -3'
(R):5'- CTCCAATGCAAACTGTGAGG -3'

Posted On

2013-06-11