Incidental Mutation 'R0562:Dsc2'
ID 45986
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2a, Dsc2b
MMRRC Submission 038753-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0562 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20163690-20192611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20174594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 521 (N521Y)
Ref Sequence ENSEMBL: ENSMUSP00000074702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: N521Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: N521Y

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: N521Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: N521Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb C T 7: 131,027,518 (GRCm39) Q63* probably null Het
Adam26b A T 8: 43,973,408 (GRCm39) N531K probably benign Het
Agt A G 8: 125,286,014 (GRCm39) I356T probably benign Het
Ankmy1 A T 1: 92,827,413 (GRCm39) probably benign Het
Anxa3 C T 5: 96,960,743 (GRCm39) S49L possibly damaging Het
Arap3 C A 18: 38,108,593 (GRCm39) R1279L probably damaging Het
Azin1 A G 15: 38,493,825 (GRCm39) I266T probably benign Het
Btnl7-ps T C 17: 34,752,498 (GRCm39) noncoding transcript Het
Car5a T A 8: 122,671,469 (GRCm39) T22S probably benign Het
Card6 A G 15: 5,134,648 (GRCm39) I185T probably damaging Het
Ccdc81 T C 7: 89,552,437 (GRCm39) D11G probably benign Het
Cep170b T C 12: 112,705,623 (GRCm39) V1127A probably benign Het
Ces1h T C 8: 94,083,771 (GRCm39) I390M unknown Het
Col9a1 T A 1: 24,218,360 (GRCm39) probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Cyb561a3 T C 19: 10,564,074 (GRCm39) V138A probably benign Het
Dcaf1 T C 9: 106,721,321 (GRCm39) probably benign Het
Dnah17 A G 11: 117,963,726 (GRCm39) Y2516H probably damaging Het
Dst G A 1: 34,267,062 (GRCm39) E4835K probably damaging Het
Duox2 T C 2: 122,120,080 (GRCm39) E810G probably damaging Het
Dusp15 T C 2: 152,793,268 (GRCm39) N3S possibly damaging Het
Eif1ad9 A G 12: 88,296,436 (GRCm39) D138G unknown Het
Epha4 T C 1: 77,365,124 (GRCm39) K625R probably benign Het
Fcgbpl1 G A 7: 27,862,115 (GRCm39) V2394I probably benign Het
Gata5 C T 2: 179,969,552 (GRCm39) probably null Het
Grm5 A G 7: 87,252,227 (GRCm39) N159S probably damaging Het
Hivep3 T A 4: 119,953,751 (GRCm39) M689K probably benign Het
Ift56 T A 6: 38,378,064 (GRCm39) V292E probably damaging Het
Ilvbl G T 10: 78,419,321 (GRCm39) G499C probably damaging Het
Inpp4b T C 8: 82,494,780 (GRCm39) I65T possibly damaging Het
Jarid2 T C 13: 45,055,835 (GRCm39) V208A probably damaging Het
Kcnh4 T C 11: 100,641,070 (GRCm39) M460V possibly damaging Het
Klhl22 A G 16: 17,610,488 (GRCm39) N580D probably benign Het
Klk15 T A 7: 43,588,269 (GRCm39) C192* probably null Het
Klk1b9 A G 7: 43,445,090 (GRCm39) E194G probably damaging Het
Lama1 G T 17: 68,122,954 (GRCm39) G2779V probably damaging Het
Lmln C T 16: 32,937,455 (GRCm39) R607* probably null Het
Maea T C 5: 33,529,645 (GRCm39) V377A probably benign Het
Matk A T 10: 81,095,525 (GRCm39) Y115F probably benign Het
Mettl18 A G 1: 163,824,062 (GRCm39) K128E probably benign Het
Mrps22 T C 9: 98,474,746 (GRCm39) H246R probably benign Het
Msln A T 17: 25,971,980 (GRCm39) M79K probably benign Het
Myf6 G A 10: 107,330,420 (GRCm39) P49L probably benign Het
Nat1 C T 8: 67,943,963 (GRCm39) T113I possibly damaging Het
Ncor2 C T 5: 125,162,093 (GRCm39) V394M unknown Het
Oas1c T C 5: 120,943,669 (GRCm39) probably benign Het
Or8k21 T A 2: 86,144,869 (GRCm39) T254S probably benign Het
Otp A T 13: 95,013,917 (GRCm39) T112S probably damaging Het
Pcdh7 A G 5: 57,877,405 (GRCm39) N320S probably damaging Het
Pdzd2 G T 15: 12,592,364 (GRCm39) F93L probably damaging Het
Phf20l1 A G 15: 66,481,453 (GRCm39) E283G probably damaging Het
Polr1e T C 4: 45,029,421 (GRCm39) F342S probably damaging Het
Pp2d1 T A 17: 53,846,196 (GRCm39) probably benign Het
Ptpn13 T A 5: 103,664,291 (GRCm39) probably null Het
Reg3g A T 6: 78,444,471 (GRCm39) H107Q possibly damaging Het
Rgl1 T C 1: 152,415,696 (GRCm39) K408E probably damaging Het
Samd4 T C 14: 47,314,966 (GRCm39) C309R probably damaging Het
Sestd1 C A 2: 77,061,066 (GRCm39) W104L probably benign Het
Sfmbt1 T A 14: 30,533,330 (GRCm39) probably null Het
Slc22a21 T A 11: 53,870,446 (GRCm39) K80* probably null Het
Snx20 T A 8: 89,356,630 (GRCm39) Q62L probably benign Het
Spef1l T C 7: 139,557,026 (GRCm39) M120V probably benign Het
Stk40 C A 4: 126,032,594 (GRCm39) probably benign Het
Taf2 A T 15: 54,885,584 (GRCm39) probably benign Het
Tcf23 C T 5: 31,127,654 (GRCm39) P152L probably damaging Het
Tex29 T C 8: 11,894,138 (GRCm39) probably benign Het
Tjp3 A G 10: 81,116,389 (GRCm39) V235A probably damaging Het
Tns3 A T 11: 8,443,262 (GRCm39) I367N possibly damaging Het
Ttn T A 2: 76,543,255 (GRCm39) M33244L probably benign Het
Ush2a A T 1: 188,089,044 (GRCm39) N333I probably damaging Het
Usp34 T C 11: 23,382,406 (GRCm39) probably benign Het
Vmn1r204 A C 13: 22,740,848 (GRCm39) S160R probably benign Het
Vmn2r75 C T 7: 85,797,449 (GRCm39) W788* probably null Het
Vwa5b1 T C 4: 138,363,022 (GRCm39) probably benign Het
Zbtb7a A G 10: 80,984,163 (GRCm39) E535G probably benign Het
Zfp1004 T A 2: 150,034,494 (GRCm39) C303S probably damaging Het
Zranb3 T C 1: 127,964,295 (GRCm39) D144G probably benign Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20,174,854 (GRCm39) missense probably benign 0.01
IGL00826:Dsc2 APN 18 20,168,372 (GRCm39) missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20,167,740 (GRCm39) missense probably benign 0.01
IGL01082:Dsc2 APN 18 20,176,849 (GRCm39) missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20,181,343 (GRCm39) missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20,180,214 (GRCm39) missense probably benign 0.19
IGL01727:Dsc2 APN 18 20,171,257 (GRCm39) missense probably benign 0.01
IGL01766:Dsc2 APN 18 20,179,399 (GRCm39) missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20,176,790 (GRCm39) missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20,178,596 (GRCm39) missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20,174,788 (GRCm39) missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20,180,136 (GRCm39) missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20,179,300 (GRCm39) missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20,179,334 (GRCm39) nonsense probably null
R0288:Dsc2 UTSW 18 20,166,177 (GRCm39) missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20,184,283 (GRCm39) missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20,174,509 (GRCm39) missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20,183,116 (GRCm39) missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20,166,352 (GRCm39) missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20,165,269 (GRCm39) missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20,178,622 (GRCm39) missense probably benign 0.40
R1515:Dsc2 UTSW 18 20,167,758 (GRCm39) missense probably damaging 0.99
R1558:Dsc2 UTSW 18 20,183,208 (GRCm39) missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20,179,303 (GRCm39) missense probably benign 0.01
R2061:Dsc2 UTSW 18 20,165,456 (GRCm39) missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20,166,351 (GRCm39) missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20,178,559 (GRCm39) missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20,168,369 (GRCm39) missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20,178,526 (GRCm39) missense probably benign 0.00
R2927:Dsc2 UTSW 18 20,178,558 (GRCm39) missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20,165,408 (GRCm39) missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20,184,284 (GRCm39) missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20,183,125 (GRCm39) missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20,174,876 (GRCm39) missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20,183,214 (GRCm39) missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20,183,199 (GRCm39) missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20,167,640 (GRCm39) critical splice donor site probably null
R5445:Dsc2 UTSW 18 20,168,360 (GRCm39) missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20,179,336 (GRCm39) missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20,168,447 (GRCm39) missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20,165,567 (GRCm39) missense probably benign 0.00
R6102:Dsc2 UTSW 18 20,180,165 (GRCm39) missense probably benign 0.01
R6129:Dsc2 UTSW 18 20,178,487 (GRCm39) missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20,168,520 (GRCm39) nonsense probably null
R6433:Dsc2 UTSW 18 20,184,232 (GRCm39) critical splice donor site probably null
R6513:Dsc2 UTSW 18 20,179,295 (GRCm39) missense probably benign
R6615:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20,165,335 (GRCm39) missense probably benign 0.22
R6665:Dsc2 UTSW 18 20,183,205 (GRCm39) missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20,171,279 (GRCm39) missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20,168,332 (GRCm39) critical splice donor site probably null
R7275:Dsc2 UTSW 18 20,184,236 (GRCm39) nonsense probably null
R7352:Dsc2 UTSW 18 20,168,392 (GRCm39) missense probably benign 0.39
R7386:Dsc2 UTSW 18 20,174,983 (GRCm39) missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20,168,451 (GRCm39) nonsense probably null
R7510:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20,183,130 (GRCm39) missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20,174,835 (GRCm39) missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20,181,373 (GRCm39) missense probably benign 0.16
R7733:Dsc2 UTSW 18 20,181,372 (GRCm39) missense probably benign 0.00
R7818:Dsc2 UTSW 18 20,183,189 (GRCm39) missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20,179,342 (GRCm39) missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20,167,720 (GRCm39) missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20,165,331 (GRCm39) missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20,165,576 (GRCm39) missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20,167,722 (GRCm39) nonsense probably null
R9005:Dsc2 UTSW 18 20,171,151 (GRCm39) missense probably benign 0.00
R9017:Dsc2 UTSW 18 20,176,968 (GRCm39) missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20,167,764 (GRCm39) missense probably benign 0.00
R9396:Dsc2 UTSW 18 20,174,773 (GRCm39) nonsense probably null
R9487:Dsc2 UTSW 18 20,180,276 (GRCm39) missense probably damaging 0.99
R9663:Dsc2 UTSW 18 20,171,205 (GRCm39) missense probably damaging 1.00
Z1088:Dsc2 UTSW 18 20,179,361 (GRCm39) missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20,168,356 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTGATCCAGAGCACCATGAC -3'
(R):5'- CCGAGTGTATCCCTCCAATGCAAAC -3'

Sequencing Primer
(F):5'- GAGCACCATGACATTCAAAATATG -3'
(R):5'- CTCCAATGCAAACTGTGAGG -3'
Posted On 2013-06-11