Incidental Mutation 'R5064:Ascl2'
ID459863
Institutional Source Beutler Lab
Gene Symbol Ascl2
Ensembl Gene ENSMUSG00000009248
Gene Nameachaete-scute family bHLH transcription factor 2
SynonymsMash2, bHLHa45, 2410083I15Rik
MMRRC Submission 042654-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5064 (G1)
Quality Score67
Status Validated
Chromosome7
Chromosomal Location142966829-142969264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142968259 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 151 (N151D)
Ref Sequence ENSEMBL: ENSMUSP00000009392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009392] [ENSMUST00000121862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009392
AA Change: N151D

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000009392
Gene: ENSMUSG00000009248
AA Change: N151D

DomainStartEndE-ValueType
HLH 124 176 3.06e-19 SMART
low complexity region 182 195 N/A INTRINSIC
low complexity region 202 220 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121862
AA Change: N83D

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113012
Gene: ENSMUSG00000009248
AA Change: N83D

DomainStartEndE-ValueType
HLH 56 108 3.06e-19 SMART
low complexity region 114 127 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
low complexity region 162 179 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the basic helix-loop-helix (BHLH) family of transcription factors. It activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. Involved in the determination of the neuronal precursors in the peripheral nervous system and the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele or heterozygous for a maternally inherited allele exhibit embryonic lethality during organogenesis associated with abnormal embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,535,655 noncoding transcript Het
Abca12 A G 1: 71,300,960 V1082A probably damaging Het
Adamts7 T A 9: 90,195,830 Y1496N probably damaging Het
Asxl3 G T 18: 22,516,019 S355I probably benign Het
Cttnbp2 T C 6: 18,448,279 Q127R probably damaging Het
Efhc1 T A 1: 20,974,963 I401N possibly damaging Het
Eml6 C T 11: 29,749,300 V1818I probably benign Het
Fam129a A G 1: 151,689,659 I247V probably benign Het
Grin1 G T 2: 25,303,831 probably benign Het
Ints2 C T 11: 86,249,274 R244H probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mllt6 C A 11: 97,673,949 A527E probably damaging Het
Msh5 G T 17: 35,043,783 probably benign Het
Mypn T A 10: 63,123,371 D1057V possibly damaging Het
Nasp A G 4: 116,611,970 probably null Het
Nat8l T C 5: 33,996,869 V9A probably damaging Het
Nr1h2 G A 7: 44,551,649 A219V possibly damaging Het
Nup155 C A 15: 8,135,870 H663Q probably damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Plppr1 A T 4: 49,319,974 H200L probably benign Het
Por T C 5: 135,733,795 V421A probably benign Het
Pxylp1 T G 9: 96,854,800 probably benign Het
Serpina3a G A 12: 104,116,189 V74I probably benign Het
Sfxn1 T C 13: 54,085,569 I37T probably benign Het
Thsd7a G T 6: 12,330,952 T1397N possibly damaging Het
Tnrc6a T C 7: 123,186,723 probably null Het
Vmn1r55 A T 7: 5,146,929 M165K probably benign Het
Vmn2r58 A T 7: 41,837,110 M787K probably damaging Het
Vta1 G T 10: 14,705,478 probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Other mutations in Ascl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Ascl2 APN 7 142968388 missense probably benign 0.00
R0466:Ascl2 UTSW 7 142968480 missense probably benign 0.00
R1909:Ascl2 UTSW 7 142968163 missense probably damaging 1.00
R2511:Ascl2 UTSW 7 142968216 missense probably damaging 1.00
R3945:Ascl2 UTSW 7 142967971 missense probably benign 0.20
R5344:Ascl2 UTSW 7 142968699 missense possibly damaging 0.53
R7761:Ascl2 UTSW 7 142968103 missense possibly damaging 0.88
R8172:Ascl2 UTSW 7 142968599 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCTTTCCTCCGACGAGTAG -3'
(R):5'- AAGCGTCTCCGGAATTGCTG -3'

Sequencing Primer
(F):5'- CAGGACAGAGACGCGCTG -3'
(R):5'- TCCGGAATTGCTGCGCTG -3'
Posted On2017-02-27