Incidental Mutation 'R0562:Arap3'
ID45987
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
SynonymsDRAG1, E030006K04Rik, Centd3
MMRRC Submission 038753-MU
Accession Numbers

NCBI RefSeq: NM_139206.2, NM_001205336.1; MGI:2147274

Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R0562 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37972624-37997574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37975540 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1279 (R1279L)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042944
AA Change: R1279L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: R1279L

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184293
Meta Mutation Damage Score 0.4287 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (77/77)
MGI Phenotype Strain: 5428754
Lethality: E10-E11
FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,977,113 M120V probably benign Het
9530053A07Rik G A 7: 28,162,690 V2394I probably benign Het
Acadsb C T 7: 131,425,789 Q63* probably null Het
Adam26b A T 8: 43,520,371 N531K probably benign Het
Agt A G 8: 124,559,275 I356T probably benign Het
Ankmy1 A T 1: 92,899,691 probably benign Het
Anxa3 C T 5: 96,812,884 S49L possibly damaging Het
Azin1 A G 15: 38,493,581 I266T probably benign Het
Btnl7-ps T C 17: 34,533,524 noncoding transcript Het
Car5a T A 8: 121,944,730 T22S probably benign Het
Card6 A G 15: 5,105,166 I185T probably damaging Het
Ccdc81 T C 7: 89,903,229 D11G probably benign Het
Cep170b T C 12: 112,739,189 V1127A probably benign Het
Ces1h T C 8: 93,357,143 I390M unknown Het
Col9a1 T A 1: 24,179,279 probably null Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Cyb561a3 T C 19: 10,586,710 V138A probably benign Het
Dcaf1 T C 9: 106,844,122 probably benign Het
Dnah17 A G 11: 118,072,900 Y2516H probably damaging Het
Dsc2 T A 18: 20,041,537 N521Y probably damaging Het
Dst G A 1: 34,227,981 E4835K probably damaging Het
Duox2 T C 2: 122,289,599 E810G probably damaging Het
Dusp15 T C 2: 152,951,348 N3S possibly damaging Het
Epha4 T C 1: 77,388,487 K625R probably benign Het
Gata5 C T 2: 180,327,759 probably null Het
Gm10264 A G 12: 88,329,666 D138G unknown Het
Gm14139 T A 2: 150,192,574 C303S probably damaging Het
Grm5 A G 7: 87,603,019 N159S probably damaging Het
Hivep3 T A 4: 120,096,554 M689K probably benign Het
Ilvbl G T 10: 78,583,487 G499C probably damaging Het
Inpp4b T C 8: 81,768,151 I65T possibly damaging Het
Jarid2 T C 13: 44,902,359 V208A probably damaging Het
Kcnh4 T C 11: 100,750,244 M460V possibly damaging Het
Klhl22 A G 16: 17,792,624 N580D probably benign Het
Klk15 T A 7: 43,938,845 C192* probably null Het
Klk9 A G 7: 43,795,666 E194G probably damaging Het
Lama1 G T 17: 67,815,959 G2779V probably damaging Het
Lmln C T 16: 33,117,085 R607* probably null Het
Maea T C 5: 33,372,301 V377A probably benign Het
Matk A T 10: 81,259,691 Y115F probably benign Het
Mettl18 A G 1: 163,996,493 K128E probably benign Het
Mrps22 T C 9: 98,592,693 H246R probably benign Het
Msln A T 17: 25,753,006 M79K probably benign Het
Myf6 G A 10: 107,494,559 P49L probably benign Het
Nat1 C T 8: 67,491,311 T113I possibly damaging Het
Ncor2 C T 5: 125,085,029 V394M unknown Het
Oas1c T C 5: 120,805,604 probably benign Het
Olfr1053 T A 2: 86,314,525 T254S probably benign Het
Otp A T 13: 94,877,409 T112S probably damaging Het
Pcdh7 A G 5: 57,720,063 N320S probably damaging Het
Pdzd2 G T 15: 12,592,278 F93L probably damaging Het
Phf20l1 A G 15: 66,609,604 E283G probably damaging Het
Polr1e T C 4: 45,029,421 F342S probably damaging Het
Pp2d1 T A 17: 53,539,168 probably benign Het
Ptpn13 T A 5: 103,516,425 probably null Het
Reg3g A T 6: 78,467,488 H107Q possibly damaging Het
Rgl1 T C 1: 152,539,945 K408E probably damaging Het
Samd4 T C 14: 47,077,509 C309R probably damaging Het
Sestd1 C A 2: 77,230,722 W104L probably benign Het
Sfmbt1 T A 14: 30,811,373 probably null Het
Slc22a21 T A 11: 53,979,620 K80* probably null Het
Snx20 T A 8: 88,630,002 Q62L probably benign Het
Stk40 C A 4: 126,138,801 probably benign Het
Taf2 A T 15: 55,022,188 probably benign Het
Tcf23 C T 5: 30,970,310 P152L probably damaging Het
Tex29 T C 8: 11,844,138 probably benign Het
Tjp3 A G 10: 81,280,555 V235A probably damaging Het
Tns3 A T 11: 8,493,262 I367N possibly damaging Het
Ttc26 T A 6: 38,401,129 V292E probably damaging Het
Ttn T A 2: 76,712,911 M33244L probably benign Het
Ush2a A T 1: 188,356,847 N333I probably damaging Het
Usp34 T C 11: 23,432,406 probably benign Het
Vmn1r204 A C 13: 22,556,678 S160R probably benign Het
Vmn2r75 C T 7: 86,148,241 W788* probably null Het
Vwa5b1 T C 4: 138,635,711 probably benign Het
Zbtb7a A G 10: 81,148,329 E535G probably benign Het
Zranb3 T C 1: 128,036,558 D144G probably benign Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 37975926 missense probably damaging 1.00
IGL01145:Arap3 APN 18 37989179 missense probably benign
IGL01154:Arap3 APN 18 37996734 missense probably benign 0.28
IGL01305:Arap3 APN 18 37991327 critical splice donor site probably null
IGL01542:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01543:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01544:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01545:Arap3 APN 18 37990836 missense probably damaging 0.98
IGL01677:Arap3 APN 18 37996647 missense probably benign
IGL01925:Arap3 APN 18 37984246 missense probably benign 0.21
IGL01933:Arap3 APN 18 37978453 missense possibly damaging 0.65
IGL02048:Arap3 APN 18 37996979 missense possibly damaging 0.56
IGL02064:Arap3 APN 18 37991701 missense probably damaging 1.00
IGL02207:Arap3 APN 18 37987853 missense probably benign 0.00
IGL02376:Arap3 APN 18 37978453 missense possibly damaging 0.95
IGL02531:Arap3 APN 18 37989751 missense probably damaging 0.99
IGL02568:Arap3 APN 18 37996658 missense probably benign 0.32
IGL02640:Arap3 APN 18 37987802 missense possibly damaging 0.71
IGL02658:Arap3 APN 18 37990994 missense probably benign 0.09
IGL03090:Arap3 APN 18 37989112 missense probably benign 0.00
IGL03352:Arap3 APN 18 37981302 splice site probably benign
ANU22:Arap3 UTSW 18 37991327 critical splice donor site probably null
P0016:Arap3 UTSW 18 37984348 missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 37996895 missense probably benign 0.08
R0066:Arap3 UTSW 18 37996707 missense probably benign 0.01
R0324:Arap3 UTSW 18 37973225 missense possibly damaging 0.93
R1289:Arap3 UTSW 18 37981973 missense possibly damaging 0.95
R1346:Arap3 UTSW 18 37975918 missense probably damaging 1.00
R1419:Arap3 UTSW 18 37978432 missense possibly damaging 0.51
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1470:Arap3 UTSW 18 37989196 critical splice acceptor site probably null
R1537:Arap3 UTSW 18 37989684 critical splice donor site probably null
R1644:Arap3 UTSW 18 37984245 missense probably damaging 1.00
R1731:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1758:Arap3 UTSW 18 37989912 missense probably benign 0.01
R1843:Arap3 UTSW 18 37975583 missense probably damaging 1.00
R1907:Arap3 UTSW 18 37996671 missense probably benign 0.28
R1954:Arap3 UTSW 18 37982002 missense probably damaging 1.00
R2124:Arap3 UTSW 18 37973350 missense probably damaging 0.98
R2135:Arap3 UTSW 18 37974456 missense probably damaging 1.00
R2172:Arap3 UTSW 18 37990560 missense probably damaging 1.00
R2418:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2419:Arap3 UTSW 18 37989944 missense probably damaging 1.00
R2907:Arap3 UTSW 18 37990527 missense possibly damaging 0.88
R4425:Arap3 UTSW 18 37978600 missense probably damaging 1.00
R4669:Arap3 UTSW 18 37996254 missense probably benign 0.08
R4734:Arap3 UTSW 18 37996275 missense probably benign 0.00
R4815:Arap3 UTSW 18 37973243 missense probably benign
R5328:Arap3 UTSW 18 37991687 missense possibly damaging 0.92
R5350:Arap3 UTSW 18 37982035 missense probably damaging 1.00
R5466:Arap3 UTSW 18 37996736 missense probably benign 0.00
R5482:Arap3 UTSW 18 37974674 missense possibly damaging 0.95
R5572:Arap3 UTSW 18 37991066 missense probably damaging 1.00
R5779:Arap3 UTSW 18 37984365 missense probably damaging 1.00
R6053:Arap3 UTSW 18 37990771 missense probably damaging 0.98
R6144:Arap3 UTSW 18 37985433 missense probably damaging 0.98
R6166:Arap3 UTSW 18 37974370 missense probably damaging 1.00
R6248:Arap3 UTSW 18 37991354 missense probably benign 0.09
R6266:Arap3 UTSW 18 37990791 missense probably damaging 0.98
R6385:Arap3 UTSW 18 37997031 nonsense probably null
R6694:Arap3 UTSW 18 37991537 critical splice donor site probably null
R6856:Arap3 UTSW 18 37979863 missense possibly damaging 0.95
R7073:Arap3 UTSW 18 37974442 nonsense probably null
R7297:Arap3 UTSW 18 37973563 missense possibly damaging 0.81
R7352:Arap3 UTSW 18 37973278 missense probably benign 0.00
R7652:Arap3 UTSW 18 37978452 missense probably damaging 0.99
R7726:Arap3 UTSW 18 37989467
X0011:Arap3 UTSW 18 37974101 critical splice donor site probably null
X0026:Arap3 UTSW 18 37985311 critical splice donor site probably null
X0027:Arap3 UTSW 18 37973485 unclassified probably null
X0066:Arap3 UTSW 18 37991646 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCACAGATGGTCAGCCAGATG -3'
(R):5'- GGAGCCATAACTTTACCAACCCCTG -3'

Sequencing Primer
(F):5'- TGGTCAGCCAGATGGACAG -3'
(R):5'- ACCAATCTCATTGCTTCACTGG -3'
Posted On2013-06-11