Incidental Mutation 'R5926:Vps16'
ID459877
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130443556 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 806 (N806K)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: N806K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: N806K

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Abra T A 15: 41,866,254 H250L probably damaging Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyb5r4 C T 9: 87,057,261 L366F probably benign Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Dnm1 C T 2: 32,315,804 V99I probably benign Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Haus6 A T 4: 86,599,316 H270Q probably benign Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Raf1 T C 6: 115,619,898 M519V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGTCAAGGCTTTGCTTCTTG -3'
(R):5'- CAGTTTTGCCTCAAAGCCTGC -3'

Sequencing Primer
(F):5'- GTTGGGTAAGTTAGATGAAGGCCTC -3'
(R):5'- CTTTTCTTAAGCCAGACAGCATAC -3'
Posted On2017-02-28