Incidental Mutation 'R5926:Haus6'
ID459882
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86599316 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 270 (H270Q)
Ref Sequence ENSEMBL: ENSMUSP00000070504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607]
Predicted Effect probably benign
Transcript: ENSMUST00000070607
AA Change: H270Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: H270Q

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Abra T A 15: 41,866,254 H250L probably damaging Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyb5r4 C T 9: 87,057,261 L366F probably benign Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Dnm1 C T 2: 32,315,804 V99I probably benign Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Raf1 T C 6: 115,619,898 M519V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vps16 T A 2: 130,443,556 N806K probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R3962:Haus6 UTSW 4 86611804 missense possibly damaging 0.85
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
R7926:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTCCACTAGAGATTAATGACGAACAC -3'
(R):5'- AAGCTGTATTCTCCCTAAGAAGTTC -3'

Sequencing Primer
(F):5'- TGACGAACACAAATGCTTGTAGC -3'
(R):5'- GGAACTCACTCTGTAGACCAGTCTG -3'
Posted On2017-02-28