Incidental Mutation 'R5926:Raf1'
ID459889
Institutional Source Beutler Lab
Gene Symbol Raf1
Ensembl Gene ENSMUSG00000000441
Gene Namev-raf-leukemia viral oncogene 1
Synonyms6430402F14Rik, Craf1, sarcoma 3611 oncogene, c-Raf, v-Raf, Raf-1
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115618067-115676635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115619898 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 519 (M519V)
Ref Sequence ENSEMBL: ENSMUSP00000108571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000449] [ENSMUST00000000451] [ENSMUST00000112949] [ENSMUST00000203759]
Predicted Effect probably benign
Transcript: ENSMUST00000000449
SMART Domains Protein: ENSMUSP00000000449
Gene: ENSMUSG00000000439

DomainStartEndE-ValueType
ZnF_C3H1 2 28 5.02e-6 SMART
ZnF_C3H1 32 57 1.75e-5 SMART
low complexity region 58 85 N/A INTRINSIC
ZnF_C3H1 165 191 2.79e-4 SMART
RING 238 291 5.82e-6 SMART
ZnF_C3H1 322 349 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000451
AA Change: M519V

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000451
Gene: ENSMUSG00000000441
AA Change: M519V

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase 349 606 7.2e-61 PFAM
Pfam:Pkinase_Tyr 349 606 3.5e-65 PFAM
Pfam:Kinase-like 400 596 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112949
AA Change: M519V

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108571
Gene: ENSMUSG00000000441
AA Change: M519V

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase_Tyr 349 606 3.4e-64 PFAM
Pfam:Pkinase 349 608 1.1e-61 PFAM
Pfam:Kinase-like 399 596 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect probably benign
Transcript: ENSMUST00000147979
SMART Domains Protein: ENSMUSP00000115424
Gene: ENSMUSG00000000441

DomainStartEndE-ValueType
Blast:RBD 2 28 9e-7 BLAST
PDB:4IHL|P 36 71 1e-9 PDB
low complexity region 110 128 N/A INTRINSIC
PDB:3OMV|B 150 205 6e-33 PDB
SCOP:d1b6cb_ 153 205 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203276
Predicted Effect probably benign
Transcript: ENSMUST00000203759
SMART Domains Protein: ENSMUSP00000145520
Gene: ENSMUSG00000000441

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 58 1e-6 PFAM
Pfam:Pkinase 1 60 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204512
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are growth retarded, with hypocellular fetal livers, placental anomalies, and defects of skin and lungs, resulting in lethality around mid-gestation. Mice heterozygous for a knock-in allele exhibit hypertrophic cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Abra T A 15: 41,866,254 H250L probably damaging Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyb5r4 C T 9: 87,057,261 L366F probably benign Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Dnm1 C T 2: 32,315,804 V99I probably benign Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Haus6 A T 4: 86,599,316 H270Q probably benign Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vps16 T A 2: 130,443,556 N806K probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Raf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Raf1 APN 6 115676569 unclassified probably benign
IGL02379:Raf1 APN 6 115644548 missense probably benign
IGL02427:Raf1 APN 6 115631327 missense probably benign
IGL02586:Raf1 APN 6 115620306 missense probably damaging 0.98
IGL02620:Raf1 APN 6 115632887 splice site probably benign
P0028:Raf1 UTSW 6 115631205 splice site probably benign
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0116:Raf1 UTSW 6 115626383 missense probably damaging 1.00
R0147:Raf1 UTSW 6 115632973 missense probably benign
R0148:Raf1 UTSW 6 115632973 missense probably benign
R0554:Raf1 UTSW 6 115623530 missense probably benign 0.05
R0811:Raf1 UTSW 6 115626710 critical splice donor site probably null
R0812:Raf1 UTSW 6 115626710 critical splice donor site probably null
R1070:Raf1 UTSW 6 115637699 missense probably benign 0.00
R4261:Raf1 UTSW 6 115623054 critical splice acceptor site probably null
R4669:Raf1 UTSW 6 115632919 missense probably damaging 1.00
R4846:Raf1 UTSW 6 115644583 missense possibly damaging 0.91
R5038:Raf1 UTSW 6 115620235 nonsense probably null
R5214:Raf1 UTSW 6 115637622 missense possibly damaging 0.82
R5472:Raf1 UTSW 6 115626706 splice site probably null
R5511:Raf1 UTSW 6 115620256 missense probably benign 0.32
R5539:Raf1 UTSW 6 115619356 missense probably damaging 1.00
R6424:Raf1 UTSW 6 115619581 missense probably benign 0.02
R6649:Raf1 UTSW 6 115631341 missense probably benign 0.03
R7021:Raf1 UTSW 6 115620339 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGGCCTACCATGAAGATGATC -3'
(R):5'- TATCCTGGCAAAGCAACAGAGG -3'

Sequencing Primer
(F):5'- CGGCCTACCATGAAGATGATCTAAAG -3'
(R):5'- CAAAGCAACAGAGGCCAGCG -3'
Posted On2017-02-28