Incidental Mutation 'R5926:Abra'
ID459916
Institutional Source Beutler Lab
Gene Symbol Abra
Ensembl Gene ENSMUSG00000042895
Gene Nameactin-binding Rho activating protein
SynonymsSTARS, C130068O12Rik
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location41864076-41869720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41866254 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 250 (H250L)
Ref Sequence ENSEMBL: ENSMUSP00000051973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054742]
Predicted Effect probably damaging
Transcript: ENSMUST00000054742
AA Change: H250L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051973
Gene: ENSMUSG00000042895
AA Change: H250L

DomainStartEndE-ValueType
Costars 298 374 6.22e-45 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired arteriogenesis following occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyb5r4 C T 9: 87,057,261 L366F probably benign Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Dnm1 C T 2: 32,315,804 V99I probably benign Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Haus6 A T 4: 86,599,316 H270Q probably benign Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Raf1 T C 6: 115,619,898 M519V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vps16 T A 2: 130,443,556 N806K probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Abra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Abra APN 15 41866017 missense probably damaging 0.99
IGL02022:Abra APN 15 41869406 missense probably benign
IGL02370:Abra APN 15 41869244 missense probably damaging 1.00
IGL02406:Abra APN 15 41869187 missense probably damaging 1.00
R1860:Abra UTSW 15 41869034 missense probably damaging 1.00
R1861:Abra UTSW 15 41869034 missense probably damaging 1.00
R2385:Abra UTSW 15 41869353 missense probably damaging 0.97
R3718:Abra UTSW 15 41866293 missense probably benign
R4582:Abra UTSW 15 41869285 missense probably benign 0.16
R4621:Abra UTSW 15 41869224 missense probably benign 0.10
R4724:Abra UTSW 15 41865906 missense probably damaging 1.00
R6417:Abra UTSW 15 41866056 missense probably benign 0.01
R6649:Abra UTSW 15 41869233 missense probably benign
R7348:Abra UTSW 15 41866159 missense probably damaging 1.00
R7487:Abra UTSW 15 41869553 missense probably damaging 1.00
R7997:Abra UTSW 15 41866197 missense probably damaging 1.00
RF053:Abra UTSW 15 41866299 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AACCTGGATCTTGCCATCTCG -3'
(R):5'- ACTACACATGGGAAGTACACG -3'

Sequencing Primer
(F):5'- CGAGCCATTGTGCGGATAAC -3'
(R):5'- CATGGGAAGTACACGGGGTCC -3'
Posted On2017-02-28