Incidental Mutation 'R5927:Stk11ip'
ID459919
Institutional Source Beutler Lab
Gene Symbol Stk11ip
Ensembl Gene ENSMUSG00000026213
Gene Nameserine/threonine kinase 11 interacting protein
Synonyms1200014D22Rik, LKB1IP, LIP1
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75521529-75537335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75524691 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 24 (V24I)
Ref Sequence ENSEMBL: ENSMUSP00000109182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027414] [ENSMUST00000113553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027414
AA Change: V24I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027414
Gene: ENSMUSG00000026213
AA Change: V24I

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
SCOP:d1h6ua2 74 291 2e-19 SMART
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113553
AA Change: V24I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109182
Gene: ENSMUSG00000026213
AA Change: V24I

DomainStartEndE-ValueType
Pfam:LIP1 4 94 2.9e-45 PFAM
low complexity region 175 194 N/A INTRINSIC
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156838
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Stk11ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Stk11ip APN 1 75530266 missense probably damaging 1.00
IGL01776:Stk11ip APN 1 75527821 missense probably benign 0.02
IGL02752:Stk11ip APN 1 75524681 critical splice acceptor site probably null
IGL03132:Stk11ip APN 1 75536089 missense probably benign 0.00
IGL03188:Stk11ip APN 1 75534435 missense probably benign 0.00
R6768_Stk11ip_021 UTSW 1 75532635 missense probably benign
sienna UTSW 1 75527355 splice site probably null
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0617:Stk11ip UTSW 1 75532288 splice site probably null
R0712:Stk11ip UTSW 1 75527447 missense probably damaging 0.99
R1672:Stk11ip UTSW 1 75528985 nonsense probably null
R1694:Stk11ip UTSW 1 75527386 missense probably damaging 1.00
R1891:Stk11ip UTSW 1 75532416 missense probably benign 0.08
R2061:Stk11ip UTSW 1 75529584 missense possibly damaging 0.94
R2094:Stk11ip UTSW 1 75525521 splice site probably benign
R2851:Stk11ip UTSW 1 75529267 splice site probably benign
R2852:Stk11ip UTSW 1 75529267 splice site probably benign
R4765:Stk11ip UTSW 1 75527155 missense probably damaging 1.00
R4775:Stk11ip UTSW 1 75533853 missense possibly damaging 0.95
R4785:Stk11ip UTSW 1 75530281 missense possibly damaging 0.95
R5002:Stk11ip UTSW 1 75532543 intron probably benign
R5524:Stk11ip UTSW 1 75532327 missense probably damaging 1.00
R5538:Stk11ip UTSW 1 75528335 missense probably damaging 1.00
R5849:Stk11ip UTSW 1 75527355 splice site probably null
R6053:Stk11ip UTSW 1 75534255 critical splice donor site probably null
R6485:Stk11ip UTSW 1 75529968 missense possibly damaging 0.47
R6734:Stk11ip UTSW 1 75532369 missense probably benign 0.04
R6768:Stk11ip UTSW 1 75532635 missense probably benign
R7070:Stk11ip UTSW 1 75527615 missense probably benign 0.39
R7882:Stk11ip UTSW 1 75529464 missense probably benign 0.03
X0066:Stk11ip UTSW 1 75534426 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTATCAGGCTGAAAGG -3'
(R):5'- TTTCTGCAGCACATCGAAGAG -3'

Sequencing Primer
(F):5'- CTGAAAGGCTAGGATTTTTGCTC -3'
(R):5'- CAGCACATCGAAGAGGAACTG -3'
Posted On2017-02-28