Incidental Mutation 'R5927:Olfr1246'
ID459924
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89591100 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 5 (N5I)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000187990
AA Change: N5I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: N5I

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191053
AA Change: N5I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140823
Gene: ENSMUSG00000100828
AA Change: N5I

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.9e-29 PFAM
Pfam:7tm_4 137 278 1.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213221
AA Change: N5I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217192
AA Change: N5I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217254
AA Change: N5I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.4370 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
R7973:Olfr1246 UTSW 2 89590987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATGCAAGCTGTGAAGG -3'
(R):5'- GGTCGTGAGAAACAGTTCTACTTG -3'

Sequencing Primer
(F):5'- GGAGATAGACTTTTCATCACACAGC -3'
(R):5'- TCAACTGAAACTCTGTTTGGATTC -3'
Posted On2017-02-28