Incidental Mutation 'R5927:Ptgfrn'
ID459926
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Nameprostaglandin F2 receptor negative regulator
SynonymsCD9P-1, 4833445A08Rik
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101040232-101110278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101060652 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 542 (F542I)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102694
AA Change: F542I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: F542I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198037
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R7924:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGTGGCCCCTCTAGA -3'
(R):5'- GCCCAGGACGGAGAGTTTAT -3'

Sequencing Primer
(F):5'- TTCCCAGCTACTCAAGGAATGTGG -3'
(R):5'- GATCCAAAGGACTACGGA -3'
Posted On2017-02-28