Mutagenetix > Incidental Mutations

Incidental Mutation 'R5927:Ptgfrn'

459926

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

044122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101060652 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 542 (F542I)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102694
AA Change: F542I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: F542I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198037

Meta Mutation Damage Score

0.0964

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (73/73)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	T	A	3: 153,939,108	I60F	probably damaging	Het
Ankrd26	A	G	6: 118,507,636		probably null	Het
Arhgdib	A	T	6: 136,924,138	W198R	probably damaging	Het
Atad5	T	A	11: 80,127,285	I1354N	probably damaging	Het
Ccdc146	T	A	5: 21,308,621	K500*	probably null	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Cmip	A	T	8: 117,257,309	T70S	possibly damaging	Het
Col22a1	G	T	15: 72,006,966	A114E	probably damaging	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Crebzf	C	T	7: 90,444,323		probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
D630036H23Rik	C	A	12: 36,381,672		probably benign	Het
Dnah5	A	T	15: 28,335,718	T2277S	probably benign	Het
Dysf	T	A	6: 84,207,212	F2083Y	probably damaging	Het
Elavl4	T	A	4: 110,290,243		probably benign	Het
Elp3	A	G	14: 65,582,177	Y111H	probably damaging	Het
Eps8l2	A	T	7: 141,356,346	Q243L	probably benign	Het
Eri2	C	A	7: 119,786,068	L403F	probably damaging	Het
Fgfr4	T	A	13: 55,166,887	N614K	probably damaging	Het
Gm5108	T	G	5: 67,976,871	I74S	unknown	Het
Gpn1	T	C	5: 31,500,891	F130L	probably damaging	Het
Gpr176	T	A	2: 118,373,040	I50F	probably benign	Het
Gramd1a	A	G	7: 31,139,821	S221P	probably benign	Het
Hivep3	A	G	4: 120,097,108	T874A	possibly damaging	Het
Igkv12-40	A	G	6: 69,879,399		noncoding transcript	Het
Itgb2	C	A	10: 77,546,034	P57T	probably damaging	Het
Kcmf1	T	A	6: 72,843,005	D286V	possibly damaging	Het
Kcnt1	T	A	2: 25,909,376		probably benign	Het
Kif15	A	G	9: 123,017,261	S76G	probably benign	Het
Kpna3	C	T	14: 61,384,647	V223I	probably damaging	Het
Krt80	A	G	15: 101,364,208		probably benign	Het
Lama4	A	G	10: 39,072,812	Y857C	probably damaging	Het
Lcorl	G	T	5: 45,725,424		probably benign	Het
Map4k3	A	G	17: 80,613,919	V528A	probably benign	Het
Mmp8	T	A	9: 7,563,202	N255K	possibly damaging	Het
Npat	A	T	9: 53,562,221	K438*	probably null	Het
Olfr1246	T	A	2: 89,591,100	N5I	possibly damaging	Het
P4htm	T	C	9: 108,597,383	Y61C	probably damaging	Het
Polr3h	G	T	15: 81,917,279		probably null	Het
Prlr	C	T	15: 10,322,446	T176I	probably benign	Het
Psme4	T	G	11: 30,804,294	F184V	possibly damaging	Het
Rock1	T	C	18: 10,116,792	E448G	probably damaging	Het
Rpf1	A	T	3: 146,519,463		probably null	Het
Sectm1b	T	C	11: 121,055,674	I132V	probably benign	Het
Sestd1	T	A	2: 77,187,159	H688L	probably benign	Het
Sidt2	T	C	9: 45,944,454	Y530C	probably damaging	Het
Sin3a	A	T	9: 57,111,111	K938M	probably damaging	Het
Sin3b	C	A	8: 72,749,878	R647S	probably benign	Het
Slc16a14	T	C	1: 84,912,267	H439R	possibly damaging	Het
Stc1	T	C	14: 69,032,373	V134A	probably benign	Het
Stk11ip	G	A	1: 75,524,691	V24I	possibly damaging	Het
Tbx6	G	A	7: 126,784,853	A359T	possibly damaging	Het
Thra	G	A	11: 98,763,688	V295I	possibly damaging	Het
Tmem8	T	C	17: 26,121,998	Y692H	probably benign	Het
Tnr	T	C	1: 159,912,766	M1170T	probably damaging	Het
Tpcn2	T	A	7: 145,278,784	I112F	probably damaging	Het
Trdv2-2	T	C	14: 53,961,541	L96P	probably damaging	Het
Trim24	T	A	6: 37,958,569	W832R	probably damaging	Het
Usp4	T	G	9: 108,391,760	S891A	probably benign	Het
Vmn1r88	A	T	7: 13,178,513	R265S	probably benign	Het
Vmn2r118	A	G	17: 55,624,494	L60S	probably benign	Het
Wdr74	T	C	19: 8,739,833	C220R	possibly damaging	Het
Xpo1	A	T	11: 23,268,653		probably benign	Het
Xpo1	A	T	11: 23,268,656		probably benign	Het
Zfp850	C	A	7: 27,990,195	G196V	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACAGTGGCCCCTCTAGA -3'
(R):5'- GCCCAGGACGGAGAGTTTAT -3'

Sequencing Primer
(F):5'- TTCCCAGCTACTCAAGGAATGTGG -3'
(R):5'- GATCCAAAGGACTACGGA -3'

Posted On

2017-02-28