Incidental Mutation 'R0563:Tor1aip1'
ID45993
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score114
Status Validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156035808 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 143 (T143M)
Ref Sequence ENSEMBL: ENSMUSP00000137617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000097527] [ENSMUST00000111754] [ENSMUST00000111757] [ENSMUST00000128941] [ENSMUST00000130995] [ENSMUST00000133152] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
Predicted Effect probably benign
Transcript: ENSMUST00000027738
AA Change: T143M

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: T143M

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097527
AA Change: T143M

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: T143M

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111754
Predicted Effect probably benign
Transcript: ENSMUST00000111757
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123705
AA Change: T81M
SMART Domains Protein: ENSMUSP00000120602
Gene: ENSMUSG00000026466
AA Change: T81M

DomainStartEndE-ValueType
Pfam:LAP1C 1 59 4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128941
Predicted Effect probably damaging
Transcript: ENSMUST00000130995
AA Change: T143M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466
AA Change: T143M

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133152
Predicted Effect probably damaging
Transcript: ENSMUST00000136331
AA Change: T143M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466
AA Change: T143M

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136397
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141878
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141980
Predicted Effect probably benign
Transcript: ENSMUST00000169241
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0410:Tor1aip1 UTSW 1 156035940 missense possibly damaging 0.85
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 156007124 missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 156033753 missense probably damaging 0.98
R5657:Tor1aip1 UTSW 1 156007488 missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 156018488 missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 156007584 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACTGAAGCTCCAGGACTAGGCAG -3'
(R):5'- AAGGTTGGGCCATCTACGTCACAC -3'

Sequencing Primer
(F):5'- TGGACTCAATCCGGGAGTG -3'
(R):5'- AAGTGTACGGCGACTTCG -3'
Posted On2013-06-11