Incidental Mutation 'R5927:Gpn1'
ID459933
Institutional Source Beutler Lab
Gene Symbol Gpn1
Ensembl Gene ENSMUSG00000064037
Gene NameGPN-loop GTPase 1
Synonyms2410004J02Rik, Xab1
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31494741-31512904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31500891 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 130 (F130L)
Ref Sequence ENSEMBL: ENSMUSP00000076217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076949] [ENSMUST00000201053] [ENSMUST00000202394]
Predicted Effect probably damaging
Transcript: ENSMUST00000076949
AA Change: F130L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076217
Gene: ENSMUSG00000064037
AA Change: F130L

DomainStartEndE-ValueType
AAA 18 182 9.44e-4 SMART
low complexity region 263 275 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200870
Predicted Effect probably benign
Transcript: ENSMUST00000201053
SMART Domains Protein: ENSMUSP00000144015
Gene: ENSMUSG00000064037

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 73 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201942
Predicted Effect probably benign
Transcript: ENSMUST00000202394
SMART Domains Protein: ENSMUSP00000144105
Gene: ENSMUSG00000064037

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 87 1.8e-26 PFAM
Meta Mutation Damage Score 0.8759 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphatase enzyme. The encoded protein may play a role in DNA repair and may function in activation of transcription. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Gpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Gpn1 APN 5 31498401 missense probably damaging 0.99
IGL01431:Gpn1 APN 5 31507538 missense probably benign 0.00
IGL01673:Gpn1 APN 5 31494835 missense probably damaging 1.00
IGL01921:Gpn1 APN 5 31499268 missense probably damaging 0.99
IGL03243:Gpn1 APN 5 31510831 critical splice acceptor site probably null
IGL03343:Gpn1 APN 5 31504965 missense probably damaging 1.00
PIT4480001:Gpn1 UTSW 5 31497341 missense probably damaging 1.00
PIT4585001:Gpn1 UTSW 5 31509403 nonsense probably null
R0001:Gpn1 UTSW 5 31495617 splice site probably benign
R1301:Gpn1 UTSW 5 31503429 missense probably damaging 1.00
R1583:Gpn1 UTSW 5 31497338 missense possibly damaging 0.46
R1622:Gpn1 UTSW 5 31503404 missense possibly damaging 0.85
R2860:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R2861:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R4603:Gpn1 UTSW 5 31497352 critical splice donor site probably null
R4627:Gpn1 UTSW 5 31498393 nonsense probably null
R6613:Gpn1 UTSW 5 31497352 critical splice donor site probably null
R6830:Gpn1 UTSW 5 31507488 missense probably benign 0.00
R7214:Gpn1 UTSW 5 31503417 missense probably damaging 1.00
R7372:Gpn1 UTSW 5 31501121 missense probably damaging 0.99
X0062:Gpn1 UTSW 5 31495593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCTGGAGCAAACTCTTGG -3'
(R):5'- TAATCAGAGGGCTCATCACTTGC -3'

Sequencing Primer
(F):5'- CAAACTCTTGGGAATATGCAGC -3'
(R):5'- GGCTCATCACTTGCTCCCATAC -3'
Posted On2017-02-28