Incidental Mutation 'R5927:Trim24'
ID459936
Institutional Source Beutler Lab
Gene Symbol Trim24
Ensembl Gene ENSMUSG00000029833
Gene Nametripartite motif-containing 24
SynonymsA130082H20Rik, D430004I05Rik, TIF1alpha, Tif1a
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location37870811-37966296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37958569 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 832 (W832R)
Ref Sequence ENSEMBL: ENSMUSP00000113063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031859] [ENSMUST00000120238] [ENSMUST00000120428]
Predicted Effect probably damaging
Transcript: ENSMUST00000031859
AA Change: W866R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031859
Gene: ENSMUSG00000029833
AA Change: W866R

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 2.5e-10 SMART
BBOX 158 205 2e-13 SMART
BBOX 218 259 7e-14 SMART
BBC 266 392 3e-44 SMART
low complexity region 474 491 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
low complexity region 573 598 N/A INTRINSIC
low complexity region 686 709 N/A INTRINSIC
low complexity region 759 774 N/A INTRINSIC
PHD 829 872 2.1e-13 SMART
BROMO 902 1007 2.4e-40 SMART
low complexity region 1025 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120238
AA Change: W796R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114001
Gene: ENSMUSG00000029833
AA Change: W796R

DomainStartEndE-ValueType
BBOX 88 135 2e-13 SMART
BBOX 148 189 6.8e-14 SMART
BBC 196 322 3e-44 SMART
low complexity region 404 421 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 616 639 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
PHD 759 802 2e-13 SMART
BROMO 832 937 2.4e-40 SMART
low complexity region 955 963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120428
AA Change: W832R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113063
Gene: ENSMUSG00000029833
AA Change: W832R

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
RING 52 130 5.22e-8 SMART
BBOX 158 205 6.27e-11 SMART
BBOX 218 259 2.22e-11 SMART
BBC 266 392 5.86e-42 SMART
low complexity region 539 564 N/A INTRINSIC
low complexity region 652 675 N/A INTRINSIC
low complexity region 725 740 N/A INTRINSIC
PHD 795 838 3.15e-11 SMART
BROMO 868 973 3.95e-38 SMART
low complexity region 991 999 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135387
Meta Mutation Damage Score 0.9623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which are typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. This protein, which also contains a PHD/TTC finger and bromodomain important for regulating nuclear receptors and binding chromatin, has important roles in differentiation, development, and tissue homeostasis. This protein has been reported to regulate the activity of the tumor suppressor p53 and of the retinoic acid receptor. A translocation event between this gene and Braf transforming gene, which results in the fusion protein T18, has been reported in hepatocellular carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased hepatocyte ploidy and uncontrolled hepatocellular proliferation; most adult mice develop malignant hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Trim24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Trim24 APN 6 37903648 missense possibly damaging 0.76
IGL01307:Trim24 APN 6 37965635 missense possibly damaging 0.81
IGL01790:Trim24 APN 6 37945613 missense probably benign
IGL02525:Trim24 APN 6 37945718 missense probably damaging 0.99
IGL02557:Trim24 APN 6 37965499 critical splice acceptor site probably null
IGL02671:Trim24 APN 6 37960784 missense probably damaging 1.00
IGL02795:Trim24 APN 6 37919389 missense probably damaging 1.00
IGL02877:Trim24 APN 6 37965646 missense probably damaging 1.00
IGL02889:Trim24 APN 6 37957761 missense probably benign 0.02
IGL02930:Trim24 APN 6 37951445 splice site probably benign
IGL03076:Trim24 APN 6 37965632 missense probably damaging 0.98
Lithe UTSW 6 37958569 missense probably damaging 1.00
Nervous UTSW 6 37957729 missense probably damaging 1.00
pliant UTSW 6 37919491 critical splice donor site probably null
qualmish UTSW 6 37903652 critical splice donor site probably null
Queasy UTSW 6 37908305 missense probably damaging 0.99
squeamish UTSW 6 37915202 nonsense probably null
Uneasy UTSW 6 37956477 critical splice donor site probably null
PIT4651001:Trim24 UTSW 6 37900732 critical splice donor site probably null
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0037:Trim24 UTSW 6 37957549 missense probably damaging 1.00
R0183:Trim24 UTSW 6 37943480 missense possibly damaging 0.90
R0471:Trim24 UTSW 6 37915195 missense possibly damaging 0.94
R0485:Trim24 UTSW 6 37957066 missense probably damaging 1.00
R0606:Trim24 UTSW 6 37871234 missense probably benign
R0609:Trim24 UTSW 6 37957783 missense probably damaging 1.00
R0637:Trim24 UTSW 6 37958559 splice site probably null
R0734:Trim24 UTSW 6 37919465 missense possibly damaging 0.86
R0855:Trim24 UTSW 6 37915202 nonsense probably null
R1131:Trim24 UTSW 6 37957782 missense probably damaging 1.00
R1141:Trim24 UTSW 6 37915293 missense probably damaging 1.00
R1159:Trim24 UTSW 6 37956477 critical splice donor site probably null
R1460:Trim24 UTSW 6 37964826 missense probably damaging 1.00
R1672:Trim24 UTSW 6 37915279 missense probably damaging 1.00
R1868:Trim24 UTSW 6 37951512 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1888:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1894:Trim24 UTSW 6 37957078 missense probably damaging 0.99
R1913:Trim24 UTSW 6 37957815 missense probably damaging 1.00
R2254:Trim24 UTSW 6 37958677 missense probably benign
R2511:Trim24 UTSW 6 37903652 critical splice donor site probably null
R2849:Trim24 UTSW 6 37956453 missense probably damaging 0.99
R3878:Trim24 UTSW 6 37964773 missense probably benign 0.14
R4084:Trim24 UTSW 6 37915257 missense probably damaging 1.00
R4235:Trim24 UTSW 6 37964740 missense probably damaging 1.00
R4292:Trim24 UTSW 6 37900692 missense possibly damaging 0.91
R4633:Trim24 UTSW 6 37956436 missense probably damaging 0.98
R4651:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4652:Trim24 UTSW 6 37957839 critical splice donor site probably null
R4686:Trim24 UTSW 6 37908305 missense probably damaging 0.99
R5000:Trim24 UTSW 6 37958612 missense probably benign 0.01
R5213:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R5258:Trim24 UTSW 6 37919400 missense probably damaging 0.99
R5292:Trim24 UTSW 6 37903604 missense probably benign 0.23
R5395:Trim24 UTSW 6 37957744 missense probably damaging 1.00
R5547:Trim24 UTSW 6 37965550 missense probably damaging 1.00
R5666:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5670:Trim24 UTSW 6 37965601 missense probably benign 0.19
R5849:Trim24 UTSW 6 37957729 missense probably damaging 1.00
R5932:Trim24 UTSW 6 37957075 missense probably damaging 0.99
R6286:Trim24 UTSW 6 37919491 critical splice donor site probably null
R6374:Trim24 UTSW 6 37953549 missense probably benign 0.12
R6449:Trim24 UTSW 6 37903652 critical splice donor site probably null
R6723:Trim24 UTSW 6 37951468 missense probably benign 0.00
R6731:Trim24 UTSW 6 37943485 missense probably damaging 0.99
R6975:Trim24 UTSW 6 37919492 critical splice donor site probably null
R7000:Trim24 UTSW 6 37958678 missense probably benign 0.24
R7067:Trim24 UTSW 6 37957840 splice site probably null
R7126:Trim24 UTSW 6 37919457 missense probably damaging 1.00
R7162:Trim24 UTSW 6 37965521 missense possibly damaging 0.68
R7486:Trim24 UTSW 6 37957839 critical splice donor site probably null
R7779:Trim24 UTSW 6 37919397 missense probably damaging 1.00
R7779:Trim24 UTSW 6 37919398 missense probably damaging 0.99
R8070:Trim24 UTSW 6 37957726 missense probably damaging 0.99
RF007:Trim24 UTSW 6 37953536 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACCTTTGCATCACATTTCTG -3'
(R):5'- GATGAGCGTTCATGCACGAG -3'

Sequencing Primer
(F):5'- TGCATCACATTTCTGCCATTTC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
Posted On2017-02-28