Incidental Mutation 'R0563:Cdc123'
ID45994
Institutional Source Beutler Lab
Gene Symbol Cdc123
Ensembl Gene ENSMUSG00000039128
Gene Namecell division cycle 123
SynonymsG431001I09Rik
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5794294-5845164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5798401 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 269 (N269S)
Ref Sequence ENSEMBL: ENSMUSP00000043033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043864]
Predicted Effect probably benign
Transcript: ENSMUST00000043864
AA Change: N269S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043033
Gene: ENSMUSG00000039128
AA Change: N269S

DomainStartEndE-ValueType
Pfam:D123 14 314 3e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130142
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Cdc123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Cdc123 APN 2 5804935 missense probably benign 0.01
IGL00422:Cdc123 APN 2 5798449 missense probably benign 0.07
IGL01860:Cdc123 APN 2 5803941 splice site probably benign
IGL03002:Cdc123 APN 2 5798355 splice site probably benign
Sinking UTSW 2 5798363 missense possibly damaging 0.82
R1412:Cdc123 UTSW 2 5803965 missense possibly damaging 0.80
R1584:Cdc123 UTSW 2 5803977 critical splice acceptor site probably null
R1838:Cdc123 UTSW 2 5794891 splice site probably null
R2064:Cdc123 UTSW 2 5795543 splice site probably benign
R2144:Cdc123 UTSW 2 5810806 missense probably benign 0.19
R4082:Cdc123 UTSW 2 5810755 intron probably benign
R4679:Cdc123 UTSW 2 5844892 missense probably damaging 1.00
R4970:Cdc123 UTSW 2 5804937 missense possibly damaging 0.59
R5089:Cdc123 UTSW 2 5805000 missense probably benign 0.00
R5112:Cdc123 UTSW 2 5804937 missense possibly damaging 0.59
R5691:Cdc123 UTSW 2 5823175 missense probably benign 0.00
R5914:Cdc123 UTSW 2 5798363 missense possibly damaging 0.82
R7860:Cdc123 UTSW 2 5803964 missense probably benign 0.00
R7943:Cdc123 UTSW 2 5803964 missense probably benign 0.00
Z1176:Cdc123 UTSW 2 5804985 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGACGCCCCTTTAACACTGTGAC -3'
(R):5'- CACAGGATGTGCTACATGGATGACC -3'

Sequencing Primer
(F):5'- CCTTTAACACTGTGACAGGAAG -3'
(R):5'- ctacctgcctttgcctcc -3'
Posted On2013-06-11