Incidental Mutation 'R5927:Arhgdib'
ID459941
Institutional Source Beutler Lab
Gene Symbol Arhgdib
Ensembl Gene ENSMUSG00000030220
Gene NameRho, GDP dissociation inhibitor (GDI) beta
SynonymsLy-GDI, D4, Gdid4
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136923655-136941899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136924138 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 198 (W198R)
Ref Sequence ENSEMBL: ENSMUSP00000107523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032343] [ENSMUST00000032344] [ENSMUST00000111891] [ENSMUST00000111892] [ENSMUST00000204627] [ENSMUST00000204934]
Predicted Effect probably benign
Transcript: ENSMUST00000032343
SMART Domains Protein: ENSMUSP00000032343
Gene: ENSMUSG00000030219

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Pfam:Thioredoxin_6 64 251 2.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032344
AA Change: W198R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032344
Gene: ENSMUSG00000030220
AA Change: W198R

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111891
AA Change: W198R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107522
Gene: ENSMUSG00000030220
AA Change: W198R

DomainStartEndE-ValueType
Pfam:Rho_GDI 6 197 5.3e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111892
AA Change: W198R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107523
Gene: ENSMUSG00000030220
AA Change: W198R

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 197 4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162755
Predicted Effect probably benign
Transcript: ENSMUST00000204627
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204934
SMART Domains Protein: ENSMUSP00000145103
Gene: ENSMUSG00000030220

DomainStartEndE-ValueType
Pfam:Rho_GDI 1 89 1.5e-38 PFAM
Meta Mutation Damage Score 0.9033 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Rho guanine nucleotide dissociation inhibitor (GDI) family. This gene is expressed at high levels in hematopoietic cells. This protein is cytosolic, and dissociation of Rho from this protein is required for membrane association and activation of Rho by Guanine Nucleotide Exchange Factors (GEFs). C-terminal truncations of this gene product have been reported to promote metastasis. Multiple transcript variants and protein isoforms exist. [provided by RefSeq, Aug 2014]
PHENOTYPE: A homozygous null mutation results in mice that are viable and fertile. Immune responses are similar to controls in mice, but in vitro analysis demonstrated an increased B cell proliferative response upon lectin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Arhgdib
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Arhgdib APN 6 136933624 missense probably damaging 1.00
IGL01712:Arhgdib APN 6 136924197 missense probably damaging 1.00
IGL02589:Arhgdib APN 6 136933578 intron probably benign
IGL02648:Arhgdib APN 6 136933649 missense probably damaging 1.00
IGL02682:Arhgdib APN 6 136924168 missense probably damaging 1.00
IGL03381:Arhgdib APN 6 136932316 missense probably benign 0.30
K7371:Arhgdib UTSW 6 136932299 splice site probably null
PIT4810001:Arhgdib UTSW 6 136924164 missense probably damaging 1.00
R0270:Arhgdib UTSW 6 136926734 missense probably damaging 1.00
R1755:Arhgdib UTSW 6 136929614 nonsense probably null
R4289:Arhgdib UTSW 6 136924158 missense probably benign 0.02
R6364:Arhgdib UTSW 6 136932255 splice site probably null
R8010:Arhgdib UTSW 6 136926722 missense probably damaging 1.00
R8031:Arhgdib UTSW 6 136924276 missense probably benign 0.10
Z1088:Arhgdib UTSW 6 136933618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGTTTTAAGTCTCATTTGCAG -3'
(R):5'- CCACATTCATGGTTGGCAGC -3'

Sequencing Primer
(F):5'- GTCTCATTTGCAGGGAACAC -3'
(R):5'- CACATTCATGGTTGGCAGCTATGG -3'
Posted On2017-02-28