Incidental Mutation 'R5927:Cpeb1'
ID459945
Institutional Source Beutler Lab
Gene Symbol Cpeb1
Ensembl Gene ENSMUSG00000025586
Gene Namecytoplasmic polyadenylation element binding protein 1
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81347026-81455465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81361680 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 171 (D171G)
Ref Sequence ENSEMBL: ENSMUSP00000137079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098331
AA Change: D170G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586
AA Change: D170G

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130310
AA Change: D165G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586
AA Change: D165G

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153419
Predicted Effect possibly damaging
Transcript: ENSMUST00000178892
AA Change: D171G

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586
AA Change: D171G

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Cpeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cpeb1 APN 7 81372181 missense probably benign
IGL01598:Cpeb1 APN 7 81361801 missense probably benign
IGL02214:Cpeb1 APN 7 81372057 missense possibly damaging 0.89
IGL02527:Cpeb1 APN 7 81359887 missense probably damaging 1.00
IGL02878:Cpeb1 APN 7 81357326 missense probably damaging 1.00
IGL03065:Cpeb1 APN 7 81436290 missense probably benign 0.39
IGL03305:Cpeb1 APN 7 81361716 missense probably benign 0.16
PIT4458001:Cpeb1 UTSW 7 81348432 missense probably damaging 1.00
R0391:Cpeb1 UTSW 7 81361725 missense possibly damaging 0.89
R0711:Cpeb1 UTSW 7 81351870 missense probably benign 0.01
R1626:Cpeb1 UTSW 7 81436247 missense probably damaging 1.00
R1723:Cpeb1 UTSW 7 81436226 missense probably benign 0.29
R1902:Cpeb1 UTSW 7 81372119 missense probably benign 0.03
R4614:Cpeb1 UTSW 7 81436270 missense possibly damaging 0.46
R4773:Cpeb1 UTSW 7 81355947 missense probably benign
R5256:Cpeb1 UTSW 7 81351839 missense probably damaging 1.00
R5750:Cpeb1 UTSW 7 81436351 missense probably benign 0.01
R6000:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6526:Cpeb1 UTSW 7 81361669 missense probably benign
RF005:Cpeb1 UTSW 7 81361806 missense possibly damaging 0.79
X0067:Cpeb1 UTSW 7 81359727 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGCACCCCTTTCAATCTC -3'
(R):5'- AGAGGTTAAATCTGCCTTGGG -3'

Sequencing Primer
(F):5'- CTAAGACAGATACTGTAGCATCTTCC -3'
(R):5'- AAGAGGTTATGAGCATTCCTTTTC -3'
Posted On2017-02-28