Mutagenetix > Incidental Mutations

Incidental Mutation 'R5927:Eps8l2'

459949

Institutional Source

Beutler Lab

Gene Symbol

Eps8l2

Ensembl Gene

ENSMUSG00000025504

Gene Name

EPS8-like 2

Synonyms

MMRRC Submission

044122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141338880-141363020 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141356346 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 243 (Q243L)

Ref Sequence

ENSEMBL: ENSMUSP00000026577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000143633]

Predicted Effect

probably benign
Transcript: ENSMUST00000026577
AA Change: Q243L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: Q243L

Domain	Start	End	E-Value	Type
Pfam:PTB	51	181	6.6e-50	PFAM
Pfam:PID	52	175	5.9e-9	PFAM
low complexity region	196	209	N/A	INTRINSIC
low complexity region	284	299	N/A	INTRINSIC
SH3	498	553	2.11e-15	SMART
PDB:1WWU\|A	614	700	2e-46	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127501

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129373

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133669

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140025

Predicted Effect

probably benign
Transcript: ENSMUST00000143633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145108

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210158

Meta Mutation Damage Score

0.0730

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	T	A	3: 153,939,108	I60F	probably damaging	Het
Ankrd26	A	G	6: 118,507,636		probably null	Het
Arhgdib	A	T	6: 136,924,138	W198R	probably damaging	Het
Atad5	T	A	11: 80,127,285	I1354N	probably damaging	Het
Ccdc146	T	A	5: 21,308,621	K500*	probably null	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Cmip	A	T	8: 117,257,309	T70S	possibly damaging	Het
Col22a1	G	T	15: 72,006,966	A114E	probably damaging	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Crebzf	C	T	7: 90,444,323		probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
D630036H23Rik	C	A	12: 36,381,672		probably benign	Het
Dnah5	A	T	15: 28,335,718	T2277S	probably benign	Het
Dysf	T	A	6: 84,207,212	F2083Y	probably damaging	Het
Elavl4	T	A	4: 110,290,243		probably benign	Het
Elp3	A	G	14: 65,582,177	Y111H	probably damaging	Het
Eri2	C	A	7: 119,786,068	L403F	probably damaging	Het
Fgfr4	T	A	13: 55,166,887	N614K	probably damaging	Het
Gm5108	T	G	5: 67,976,871	I74S	unknown	Het
Gpn1	T	C	5: 31,500,891	F130L	probably damaging	Het
Gpr176	T	A	2: 118,373,040	I50F	probably benign	Het
Gramd1a	A	G	7: 31,139,821	S221P	probably benign	Het
Hivep3	A	G	4: 120,097,108	T874A	possibly damaging	Het
Igkv12-40	A	G	6: 69,879,399		noncoding transcript	Het
Itgb2	C	A	10: 77,546,034	P57T	probably damaging	Het
Kcmf1	T	A	6: 72,843,005	D286V	possibly damaging	Het
Kcnt1	T	A	2: 25,909,376		probably benign	Het
Kif15	A	G	9: 123,017,261	S76G	probably benign	Het
Kpna3	C	T	14: 61,384,647	V223I	probably damaging	Het
Krt80	A	G	15: 101,364,208		probably benign	Het
Lama4	A	G	10: 39,072,812	Y857C	probably damaging	Het
Lcorl	G	T	5: 45,725,424		probably benign	Het
Map4k3	A	G	17: 80,613,919	V528A	probably benign	Het
Mmp8	T	A	9: 7,563,202	N255K	possibly damaging	Het
Npat	A	T	9: 53,562,221	K438*	probably null	Het
Olfr1246	T	A	2: 89,591,100	N5I	possibly damaging	Het
P4htm	T	C	9: 108,597,383	Y61C	probably damaging	Het
Polr3h	G	T	15: 81,917,279		probably null	Het
Prlr	C	T	15: 10,322,446	T176I	probably benign	Het
Psme4	T	G	11: 30,804,294	F184V	possibly damaging	Het
Ptgfrn	A	T	3: 101,060,652	F542I	possibly damaging	Het
Rock1	T	C	18: 10,116,792	E448G	probably damaging	Het
Rpf1	A	T	3: 146,519,463		probably null	Het
Sectm1b	T	C	11: 121,055,674	I132V	probably benign	Het
Sestd1	T	A	2: 77,187,159	H688L	probably benign	Het
Sidt2	T	C	9: 45,944,454	Y530C	probably damaging	Het
Sin3a	A	T	9: 57,111,111	K938M	probably damaging	Het
Sin3b	C	A	8: 72,749,878	R647S	probably benign	Het
Slc16a14	T	C	1: 84,912,267	H439R	possibly damaging	Het
Stc1	T	C	14: 69,032,373	V134A	probably benign	Het
Stk11ip	G	A	1: 75,524,691	V24I	possibly damaging	Het
Tbx6	G	A	7: 126,784,853	A359T	possibly damaging	Het
Thra	G	A	11: 98,763,688	V295I	possibly damaging	Het
Tmem8	T	C	17: 26,121,998	Y692H	probably benign	Het
Tnr	T	C	1: 159,912,766	M1170T	probably damaging	Het
Tpcn2	T	A	7: 145,278,784	I112F	probably damaging	Het
Trdv2-2	T	C	14: 53,961,541	L96P	probably damaging	Het
Trim24	T	A	6: 37,958,569	W832R	probably damaging	Het
Usp4	T	G	9: 108,391,760	S891A	probably benign	Het
Vmn1r88	A	T	7: 13,178,513	R265S	probably benign	Het
Vmn2r118	A	G	17: 55,624,494	L60S	probably benign	Het
Wdr74	T	C	19: 8,739,833	C220R	possibly damaging	Het
Xpo1	A	T	11: 23,268,653		probably benign	Het
Xpo1	A	T	11: 23,268,656		probably benign	Het
Zfp850	C	A	7: 27,990,195	G196V	probably benign	Het

Other mutations in Eps8l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Eps8l2	APN	7	141357663	missense	probably benign	0.06
IGL01444:Eps8l2	APN	7	141361375	splice site	probably benign
IGL01467:Eps8l2	APN	7	141361601	missense	probably damaging	1.00
IGL01803:Eps8l2	APN	7	141358230	missense	probably benign
IGL02598:Eps8l2	APN	7	141354936	splice site	probably benign
IGL02823:Eps8l2	APN	7	141342075	missense	probably damaging	1.00
IGL03061:Eps8l2	APN	7	141357235	unclassified	probably benign
IGL03112:Eps8l2	APN	7	141361736	missense	probably damaging	1.00
IGL03251:Eps8l2	APN	7	141342962	missense	probably damaging	1.00
R0057:Eps8l2	UTSW	7	141342971	missense	probably benign	0.08
R0133:Eps8l2	UTSW	7	141362207	missense	unknown
R0361:Eps8l2	UTSW	7	141356199	missense	probably benign	0.05
R0409:Eps8l2	UTSW	7	141342980	missense	probably damaging	1.00
R0611:Eps8l2	UTSW	7	141355733	missense	probably damaging	1.00
R1487:Eps8l2	UTSW	7	141361618	missense	probably benign
R1679:Eps8l2	UTSW	7	141361057	missense	probably damaging	1.00
R1914:Eps8l2	UTSW	7	141361852	missense	probably damaging	1.00
R1915:Eps8l2	UTSW	7	141361852	missense	probably damaging	1.00
R1918:Eps8l2	UTSW	7	141361724	missense	probably damaging	0.99
R2098:Eps8l2	UTSW	7	141355792	splice site	probably null
R2170:Eps8l2	UTSW	7	141342071	missense	probably benign	0.02
R3429:Eps8l2	UTSW	7	141357919	critical splice donor site	probably null
R3734:Eps8l2	UTSW	7	141357821	missense	probably damaging	1.00
R4296:Eps8l2	UTSW	7	141358262	nonsense	probably null
R4701:Eps8l2	UTSW	7	141357260	missense	probably damaging	1.00
R4758:Eps8l2	UTSW	7	141360373	missense	probably damaging	0.98
R5564:Eps8l2	UTSW	7	141356621	missense	possibly damaging	0.94
R5567:Eps8l2	UTSW	7	141355007	missense	possibly damaging	0.95
R5570:Eps8l2	UTSW	7	141355007	missense	possibly damaging	0.95
R5735:Eps8l2	UTSW	7	141360377	missense	probably damaging	1.00
R5893:Eps8l2	UTSW	7	141357624	missense	probably damaging	1.00
R5905:Eps8l2	UTSW	7	141357833	missense	possibly damaging	0.89
R6028:Eps8l2	UTSW	7	141357833	missense	possibly damaging	0.89
R6248:Eps8l2	UTSW	7	141342102	missense	probably damaging	0.99
R6631:Eps8l2	UTSW	7	141356202	missense	probably damaging	1.00
R7152:Eps8l2	UTSW	7	141355765	missense	possibly damaging	0.95
R7231:Eps8l2	UTSW	7	141360392	missense	probably damaging	1.00
R8071:Eps8l2	UTSW	7	141342947	missense	probably damaging	1.00
Z1177:Eps8l2	UTSW	7	141342095	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCAGCGGCAGTCTATCTTAC -3'
(R):5'- CCAGGGTGCAGTTAAGGATTTG -3'

Sequencing Primer
(F):5'- CAGCGACAGCCAGGAGATTC -3'
(R):5'- TTAAGGATTTGCTGAGGTTAGAAAAG -3'

Posted On

2017-02-28