Incidental Mutation 'R5927:Eps8l2'
ID459949
Institutional Source Beutler Lab
Gene Symbol Eps8l2
Ensembl Gene ENSMUSG00000025504
Gene NameEPS8-like 2
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141338880-141363020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141356346 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 243 (Q243L)
Ref Sequence ENSEMBL: ENSMUSP00000026577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000143633]
Predicted Effect probably benign
Transcript: ENSMUST00000026577
AA Change: Q243L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: Q243L

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect probably benign
Transcript: ENSMUST00000143633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210158
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Eps8l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Eps8l2 APN 7 141357663 missense probably benign 0.06
IGL01444:Eps8l2 APN 7 141361375 splice site probably benign
IGL01467:Eps8l2 APN 7 141361601 missense probably damaging 1.00
IGL01803:Eps8l2 APN 7 141358230 missense probably benign
IGL02598:Eps8l2 APN 7 141354936 splice site probably benign
IGL02823:Eps8l2 APN 7 141342075 missense probably damaging 1.00
IGL03061:Eps8l2 APN 7 141357235 unclassified probably benign
IGL03112:Eps8l2 APN 7 141361736 missense probably damaging 1.00
IGL03251:Eps8l2 APN 7 141342962 missense probably damaging 1.00
R0057:Eps8l2 UTSW 7 141342971 missense probably benign 0.08
R0133:Eps8l2 UTSW 7 141362207 missense unknown
R0361:Eps8l2 UTSW 7 141356199 missense probably benign 0.05
R0409:Eps8l2 UTSW 7 141342980 missense probably damaging 1.00
R0611:Eps8l2 UTSW 7 141355733 missense probably damaging 1.00
R1487:Eps8l2 UTSW 7 141361618 missense probably benign
R1679:Eps8l2 UTSW 7 141361057 missense probably damaging 1.00
R1914:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1915:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1918:Eps8l2 UTSW 7 141361724 missense probably damaging 0.99
R2098:Eps8l2 UTSW 7 141355792 unclassified probably null
R2170:Eps8l2 UTSW 7 141342071 missense probably benign 0.02
R3429:Eps8l2 UTSW 7 141357919 critical splice donor site probably null
R3734:Eps8l2 UTSW 7 141357821 missense probably damaging 1.00
R4296:Eps8l2 UTSW 7 141358262 nonsense probably null
R4701:Eps8l2 UTSW 7 141357260 missense probably damaging 1.00
R4758:Eps8l2 UTSW 7 141360373 missense probably damaging 0.98
R5564:Eps8l2 UTSW 7 141356621 missense possibly damaging 0.94
R5567:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5570:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5735:Eps8l2 UTSW 7 141360377 missense probably damaging 1.00
R5893:Eps8l2 UTSW 7 141357624 missense probably damaging 1.00
R5905:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6028:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6248:Eps8l2 UTSW 7 141342102 missense probably damaging 0.99
R6631:Eps8l2 UTSW 7 141356202 missense probably damaging 1.00
R7152:Eps8l2 UTSW 7 141355765 missense possibly damaging 0.95
R7231:Eps8l2 UTSW 7 141360392 missense probably damaging 1.00
Z1177:Eps8l2 UTSW 7 141342095 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAGCGGCAGTCTATCTTAC -3'
(R):5'- CCAGGGTGCAGTTAAGGATTTG -3'

Sequencing Primer
(F):5'- CAGCGACAGCCAGGAGATTC -3'
(R):5'- TTAAGGATTTGCTGAGGTTAGAAAAG -3'
Posted On2017-02-28