Incidental Mutation 'R5927:Sidt2'
ID459954
Institutional Source Beutler Lab
Gene Symbol Sidt2
Ensembl Gene ENSMUSG00000034908
Gene NameSID1 transmembrane family, member 2
SynonymsCGI-40
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5927 (G1)
Quality Score223
Status Validated
Chromosome9
Chromosomal Location45937857-45955258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45944454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 530 (Y530C)
Ref Sequence ENSEMBL: ENSMUSP00000110220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038488] [ENSMUST00000114573] [ENSMUST00000160138] [ENSMUST00000160618] [ENSMUST00000162072] [ENSMUST00000162379] [ENSMUST00000162529]
Predicted Effect probably damaging
Transcript: ENSMUST00000038488
AA Change: Y509C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044290
Gene: ENSMUSG00000034908
AA Change: Y509C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 832 8.5e-214 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114573
AA Change: Y530C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110220
Gene: ENSMUSG00000034908
AA Change: Y530C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 853 9e-290 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159033
SMART Domains Protein: ENSMUSP00000125273
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
Pfam:SID-1_RNA_chan 30 74 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160138
SMART Domains Protein: ENSMUSP00000124945
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160598
Predicted Effect probably benign
Transcript: ENSMUST00000160618
SMART Domains Protein: ENSMUSP00000125037
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160927
Predicted Effect probably benign
Transcript: ENSMUST00000161042
SMART Domains Protein: ENSMUSP00000124577
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161606
SMART Domains Protein: ENSMUSP00000125660
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 221 4.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162072
SMART Domains Protein: ENSMUSP00000124750
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 338 2.3e-34 PFAM
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162379
SMART Domains Protein: ENSMUSP00000124503
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 3.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162529
SMART Domains Protein: ENSMUSP00000125060
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 9.2e-20 PFAM
low complexity region 202 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184840
Meta Mutation Damage Score 0.8862 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit male-specific decreased body weight and size, impaired glucose tolerance, increased serum glucose, decreased serum insulin and decreased insule granule release from beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Sidt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Sidt2 APN 9 45942236 missense possibly damaging 0.84
IGL00586:Sidt2 APN 9 45943052 missense possibly damaging 0.78
IGL00786:Sidt2 APN 9 45949803 missense possibly damaging 0.69
IGL01069:Sidt2 APN 9 45943077 missense possibly damaging 0.73
IGL01160:Sidt2 APN 9 45942726 missense probably damaging 1.00
IGL01474:Sidt2 APN 9 45946982 critical splice donor site probably null
IGL02068:Sidt2 APN 9 45945664 critical splice donor site probably null
IGL02171:Sidt2 APN 9 45952770 missense possibly damaging 0.81
IGL02312:Sidt2 APN 9 45947001 missense probably benign 0.27
IGL02344:Sidt2 APN 9 45945292 missense probably null 1.00
IGL03030:Sidt2 APN 9 45939505 missense probably damaging 1.00
IGL03062:Sidt2 APN 9 45942683 critical splice donor site probably null
R0157:Sidt2 UTSW 9 45939267 missense probably damaging 1.00
R0330:Sidt2 UTSW 9 45954902 missense probably benign 0.09
R0549:Sidt2 UTSW 9 45953119 splice site probably null
R0714:Sidt2 UTSW 9 45947060 splice site probably benign
R1241:Sidt2 UTSW 9 45945704 missense probably damaging 0.97
R1511:Sidt2 UTSW 9 45950089 missense probably damaging 1.00
R1558:Sidt2 UTSW 9 45951800 missense probably damaging 1.00
R1677:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R2152:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2153:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2154:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R4210:Sidt2 UTSW 9 45942775 missense probably benign 0.00
R4349:Sidt2 UTSW 9 45945713 missense possibly damaging 0.94
R4855:Sidt2 UTSW 9 45952029 missense probably benign
R5069:Sidt2 UTSW 9 45939461 unclassified probably null
R5175:Sidt2 UTSW 9 45951788 missense probably damaging 1.00
R5276:Sidt2 UTSW 9 45954777 missense probably damaging 0.97
R5544:Sidt2 UTSW 9 45944455 missense probably damaging 1.00
R5805:Sidt2 UTSW 9 45942199 missense probably damaging 0.97
R6954:Sidt2 UTSW 9 45952850 missense probably benign 0.01
R7060:Sidt2 UTSW 9 45953246 missense possibly damaging 0.91
R7117:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R7207:Sidt2 UTSW 9 45945151 missense probably damaging 1.00
R7317:Sidt2 UTSW 9 45943690 nonsense probably null
R7765:Sidt2 UTSW 9 45941575 intron probably null
R8098:Sidt2 UTSW 9 45945730 missense probably benign 0.05
X0026:Sidt2 UTSW 9 45939299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGGAGCAGAGCTGGAC -3'
(R):5'- GAGTCAGGCATGTTAATAGCTACACT -3'

Sequencing Primer
(F):5'- ACTGGGGGAGGTCAGTCTG -3'
(R):5'- AGGCATGTTAATAGCTACACTCCTCC -3'
Posted On2017-02-28