Incidental Mutation 'R5927:Npat'
ID459955
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Namenuclear protein in the AT region
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53537047-53574342 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 53562221 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 438 (K438*)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
Predicted Effect probably null
Transcript: ENSMUST00000035850
AA Change: K438*
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: K438*

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148336
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0688:Npat UTSW 9 53570222 missense probably benign 0.18
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5397:Npat UTSW 9 53570474 missense probably damaging 1.00
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 intron probably null
R7408:Npat UTSW 9 53569916 missense probably damaging 0.99
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCATCACACTGGTGTTTTACAG -3'
(R):5'- GCTGATCAGGCTGATACTGAG -3'

Sequencing Primer
(F):5'- CATCACACTGGTGTTTTACAGATGGG -3'
(R):5'- CAGGCTGATACTGAGATTGACTC -3'
Posted On2017-02-28