Incidental Mutation 'R5927:Psme4'
ID 459964
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5927 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30754294 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 184 (F184V)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: F184V

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: F184V

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154757
AA Change: F192V
SMART Domains Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: F192V

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Meta Mutation Damage Score 0.9338 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,644,745 (GRCm39) I60F probably damaging Het
Ankrd26 A G 6: 118,484,597 (GRCm39) probably null Het
Arhgdib A T 6: 136,901,136 (GRCm39) W198R probably damaging Het
Atad5 T A 11: 80,018,111 (GRCm39) I1354N probably damaging Het
Ccdc146 T A 5: 21,513,619 (GRCm39) K500* probably null Het
Cdk11b G A 4: 155,732,697 (GRCm39) probably benign Het
Cmip A T 8: 117,984,048 (GRCm39) T70S possibly damaging Het
Col22a1 G T 15: 71,878,815 (GRCm39) A114E probably damaging Het
Cpeb1 T C 7: 81,011,428 (GRCm39) D171G possibly damaging Het
Crebzf C T 7: 90,093,531 (GRCm39) probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
D630036H23Rik C A 12: 36,431,671 (GRCm39) probably benign Het
Dnah5 A T 15: 28,335,864 (GRCm39) T2277S probably benign Het
Dysf T A 6: 84,184,194 (GRCm39) F2083Y probably damaging Het
Elavl4 T A 4: 110,147,440 (GRCm39) probably benign Het
Elp3 A G 14: 65,819,626 (GRCm39) Y111H probably damaging Het
Eps8l2 A T 7: 140,936,259 (GRCm39) Q243L probably benign Het
Eri2 C A 7: 119,385,291 (GRCm39) L403F probably damaging Het
Fgfr4 T A 13: 55,314,700 (GRCm39) N614K probably damaging Het
Gm5108 T G 5: 68,134,214 (GRCm39) I74S unknown Het
Gpn1 T C 5: 31,658,235 (GRCm39) F130L probably damaging Het
Gpr176 T A 2: 118,203,521 (GRCm39) I50F probably benign Het
Gramd1a A G 7: 30,839,246 (GRCm39) S221P probably benign Het
Hivep3 A G 4: 119,954,305 (GRCm39) T874A possibly damaging Het
Igkv12-40 A G 6: 69,856,383 (GRCm39) noncoding transcript Het
Itgb2 C A 10: 77,381,868 (GRCm39) P57T probably damaging Het
Kcmf1 T A 6: 72,819,988 (GRCm39) D286V possibly damaging Het
Kcnt1 T A 2: 25,799,388 (GRCm39) probably benign Het
Kif15 A G 9: 122,846,326 (GRCm39) S76G probably benign Het
Kpna3 C T 14: 61,622,096 (GRCm39) V223I probably damaging Het
Krt80 A G 15: 101,262,089 (GRCm39) probably benign Het
Lama4 A G 10: 38,948,808 (GRCm39) Y857C probably damaging Het
Lcorl G T 5: 45,882,766 (GRCm39) probably benign Het
Map4k3 A G 17: 80,921,348 (GRCm39) V528A probably benign Het
Mmp8 T A 9: 7,563,203 (GRCm39) N255K possibly damaging Het
Npat A T 9: 53,473,521 (GRCm39) K438* probably null Het
Or4a73 T A 2: 89,421,444 (GRCm39) N5I possibly damaging Het
P4htm T C 9: 108,474,582 (GRCm39) Y61C probably damaging Het
Pgap6 T C 17: 26,340,972 (GRCm39) Y692H probably benign Het
Polr3h G T 15: 81,801,480 (GRCm39) probably null Het
Prlr C T 15: 10,322,532 (GRCm39) T176I probably benign Het
Ptgfrn A T 3: 100,967,968 (GRCm39) F542I possibly damaging Het
Rock1 T C 18: 10,116,792 (GRCm39) E448G probably damaging Het
Rpf1 A T 3: 146,225,218 (GRCm39) probably null Het
Sectm1b T C 11: 120,946,500 (GRCm39) I132V probably benign Het
Sestd1 T A 2: 77,017,503 (GRCm39) H688L probably benign Het
Sidt2 T C 9: 45,855,752 (GRCm39) Y530C probably damaging Het
Sin3a A T 9: 57,018,395 (GRCm39) K938M probably damaging Het
Sin3b C A 8: 73,476,506 (GRCm39) R647S probably benign Het
Slc16a14 T C 1: 84,889,988 (GRCm39) H439R possibly damaging Het
Stc1 T C 14: 69,269,822 (GRCm39) V134A probably benign Het
Stk11ip G A 1: 75,501,335 (GRCm39) V24I possibly damaging Het
Tbx6 G A 7: 126,384,025 (GRCm39) A359T possibly damaging Het
Thra G A 11: 98,654,514 (GRCm39) V295I possibly damaging Het
Tnr T C 1: 159,740,336 (GRCm39) M1170T probably damaging Het
Tpcn2 T A 7: 144,832,521 (GRCm39) I112F probably damaging Het
Trdv2-2 T C 14: 54,198,998 (GRCm39) L96P probably damaging Het
Trim24 T A 6: 37,935,504 (GRCm39) W832R probably damaging Het
Usp4 T G 9: 108,268,959 (GRCm39) S891A probably benign Het
Vmn1r88 A T 7: 12,912,440 (GRCm39) R265S probably benign Het
Vmn2r118 A G 17: 55,931,494 (GRCm39) L60S probably benign Het
Wdr74 T C 19: 8,717,197 (GRCm39) C220R possibly damaging Het
Xpo1 A T 11: 23,218,653 (GRCm39) probably benign Het
Xpo1 A T 11: 23,218,656 (GRCm39) probably benign Het
Zfp850 C A 7: 27,689,620 (GRCm39) G196V probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTCTTCCAAGTGTGTATGGGAG -3'
(R):5'- GGTATTCTTGCTGTATCCTAGAGC -3'

Sequencing Primer
(F):5'- GAAATATATTCCCTTCCCTCATGATG -3'
(R):5'- CTGTATCCTAGAGCATGTCAAATATG -3'
Posted On 2017-02-28