Mutagenetix > Incidental Mutation

Incidental Mutation 'R5927:Psme4'

459964

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

044122-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 30804294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 184 (F184V)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041231
AA Change: F184V

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: F184V

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000154757
AA Change: F192V

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: F192V

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Meta Mutation Damage Score

0.9338

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (73/73)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	T	A	3: 153,939,108	I60F	probably damaging	Het
Ankrd26	A	G	6: 118,507,636		probably null	Het
Arhgdib	A	T	6: 136,924,138	W198R	probably damaging	Het
Atad5	T	A	11: 80,127,285	I1354N	probably damaging	Het
Ccdc146	T	A	5: 21,308,621	K500*	probably null	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Cmip	A	T	8: 117,257,309	T70S	possibly damaging	Het
Col22a1	G	T	15: 72,006,966	A114E	probably damaging	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Crebzf	C	T	7: 90,444,323		probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
D630036H23Rik	C	A	12: 36,381,672		probably benign	Het
Dnah5	A	T	15: 28,335,718	T2277S	probably benign	Het
Dysf	T	A	6: 84,207,212	F2083Y	probably damaging	Het
Elavl4	T	A	4: 110,290,243		probably benign	Het
Elp3	A	G	14: 65,582,177	Y111H	probably damaging	Het
Eps8l2	A	T	7: 141,356,346	Q243L	probably benign	Het
Eri2	C	A	7: 119,786,068	L403F	probably damaging	Het
Fgfr4	T	A	13: 55,166,887	N614K	probably damaging	Het
Gm5108	T	G	5: 67,976,871	I74S	unknown	Het
Gpn1	T	C	5: 31,500,891	F130L	probably damaging	Het
Gpr176	T	A	2: 118,373,040	I50F	probably benign	Het
Gramd1a	A	G	7: 31,139,821	S221P	probably benign	Het
Hivep3	A	G	4: 120,097,108	T874A	possibly damaging	Het
Igkv12-40	A	G	6: 69,879,399		noncoding transcript	Het
Itgb2	C	A	10: 77,546,034	P57T	probably damaging	Het
Kcmf1	T	A	6: 72,843,005	D286V	possibly damaging	Het
Kcnt1	T	A	2: 25,909,376		probably benign	Het
Kif15	A	G	9: 123,017,261	S76G	probably benign	Het
Kpna3	C	T	14: 61,384,647	V223I	probably damaging	Het
Krt80	A	G	15: 101,364,208		probably benign	Het
Lama4	A	G	10: 39,072,812	Y857C	probably damaging	Het
Lcorl	G	T	5: 45,725,424		probably benign	Het
Map4k3	A	G	17: 80,613,919	V528A	probably benign	Het
Mmp8	T	A	9: 7,563,202	N255K	possibly damaging	Het
Npat	A	T	9: 53,562,221	K438*	probably null	Het
Olfr1246	T	A	2: 89,591,100	N5I	possibly damaging	Het
P4htm	T	C	9: 108,597,383	Y61C	probably damaging	Het
Polr3h	G	T	15: 81,917,279		probably null	Het
Prlr	C	T	15: 10,322,446	T176I	probably benign	Het
Ptgfrn	A	T	3: 101,060,652	F542I	possibly damaging	Het
Rock1	T	C	18: 10,116,792	E448G	probably damaging	Het
Rpf1	A	T	3: 146,519,463		probably null	Het
Sectm1b	T	C	11: 121,055,674	I132V	probably benign	Het
Sestd1	T	A	2: 77,187,159	H688L	probably benign	Het
Sidt2	T	C	9: 45,944,454	Y530C	probably damaging	Het
Sin3a	A	T	9: 57,111,111	K938M	probably damaging	Het
Sin3b	C	A	8: 72,749,878	R647S	probably benign	Het
Slc16a14	T	C	1: 84,912,267	H439R	possibly damaging	Het
Stc1	T	C	14: 69,032,373	V134A	probably benign	Het
Stk11ip	G	A	1: 75,524,691	V24I	possibly damaging	Het
Tbx6	G	A	7: 126,784,853	A359T	possibly damaging	Het
Thra	G	A	11: 98,763,688	V295I	possibly damaging	Het
Tmem8	T	C	17: 26,121,998	Y692H	probably benign	Het
Tnr	T	C	1: 159,912,766	M1170T	probably damaging	Het
Tpcn2	T	A	7: 145,278,784	I112F	probably damaging	Het
Trdv2-2	T	C	14: 53,961,541	L96P	probably damaging	Het
Trim24	T	A	6: 37,958,569	W832R	probably damaging	Het
Usp4	T	G	9: 108,391,760	S891A	probably benign	Het
Vmn1r88	A	T	7: 13,178,513	R265S	probably benign	Het
Vmn2r118	A	G	17: 55,624,494	L60S	probably benign	Het
Wdr74	T	C	19: 8,739,833	C220R	possibly damaging	Het
Xpo1	A	T	11: 23,268,653		probably benign	Het
Xpo1	A	T	11: 23,268,656		probably benign	Het
Zfp850	C	A	7: 27,990,195	G196V	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTCTTCCAAGTGTGTATGGGAG -3'
(R):5'- GGTATTCTTGCTGTATCCTAGAGC -3'

Sequencing Primer
(F):5'- GAAATATATTCCCTTCCCTCATGATG -3'
(R):5'- CTGTATCCTAGAGCATGTCAAATATG -3'

Posted On

2017-02-28