Incidental Mutation 'R5927:Thra'
ID459966
Institutional Source Beutler Lab
Gene Symbol Thra
Ensembl Gene ENSMUSG00000058756
Gene Namethyroid hormone receptor alpha
SynonymsTR alpha 1, Thra2, Thra1, Rvr, TR alpha 2, c-erbAalpha, 6430529J03Rik, Erba, Nr1a1, T3Ralpha, T3R[a]
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98740638-98769006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98763688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 295 (V295I)
Ref Sequence ENSEMBL: ENSMUSP00000099428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000103139] [ENSMUST00000124072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064187
AA Change: V295I

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756
AA Change: V295I

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064941
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103139
AA Change: V295I

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099428
Gene: ENSMUSG00000058756
AA Change: V295I

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 7.26e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124072
AA Change: V295I

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756
AA Change: V295I

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is one of several nuclear hormone receptors that bind thyroid hormones such as triiodothyronine and thyroxine with high affinity. The encoded protein is a transcription factor that can activate or repress transcription. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene result in diverse phenotypes depending on the location and severity of the mutation. Observed phenotypes may include alterations in thyroid physiology, intestinal remodeling, cerebellum development, bone growth, cardiac function, thermogenesis, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Thra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Thra APN 11 98762928 missense possibly damaging 0.90
IGL01544:Thra APN 11 98756928 missense possibly damaging 0.46
IGL02377:Thra APN 11 98761916 missense probably damaging 1.00
IGL02738:Thra APN 11 98764359 missense probably benign 0.40
IGL03111:Thra APN 11 98761029 unclassified probably benign
California UTSW 11 98764308 missense probably damaging 0.97
Crissal UTSW 11 98762951 missense probably benign 0.20
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0033:Thra UTSW 11 98764352 missense probably benign 0.00
R0959:Thra UTSW 11 98753629 missense possibly damaging 0.94
R1659:Thra UTSW 11 98756979 missense probably damaging 0.99
R1839:Thra UTSW 11 98756143 missense probably benign 0.01
R1859:Thra UTSW 11 98756151 missense probably damaging 0.98
R1935:Thra UTSW 11 98763073 splice site probably benign
R1956:Thra UTSW 11 98763741 missense probably benign 0.03
R4584:Thra UTSW 11 98764484 missense probably benign 0.42
R4782:Thra UTSW 11 98756164 missense probably benign 0.01
R5414:Thra UTSW 11 98760957 missense probably benign 0.34
R5790:Thra UTSW 11 98762951 missense probably benign 0.20
R7207:Thra UTSW 11 98760976 missense probably damaging 1.00
R7234:Thra UTSW 11 98763718 missense probably damaging 1.00
R7307:Thra UTSW 11 98764308 missense probably damaging 0.97
R7825:Thra UTSW 11 98762948 missense probably benign 0.14
R7875:Thra UTSW 11 98768431 missense probably damaging 0.98
R8385:Thra UTSW 11 98768351 missense probably benign 0.40
Z1177:Thra UTSW 11 98753481 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGCTCTGTGATCCTGC -3'
(R):5'- TCATAGAGAGTCAGCCTGGG -3'

Sequencing Primer
(F):5'- AGTGCTCTGTGATCCTGCTGTTC -3'
(R):5'- GGGTGAGACAGAACCTATGC -3'
Posted On2017-02-28