Incidental Mutation 'R5927:Fgfr4'
ID459969
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55166887 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 614 (N614K)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: N614K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: N614K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Meta Mutation Damage Score 0.8951 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
R7974:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
Z1177:Fgfr4 UTSW 13 55161707 missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55165929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTCTGAACAAATGTGC -3'
(R):5'- ATCCATTTGACTGGCAGGC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- ACAGTGGTGTGAGTAGTATAGGACC -3'
Posted On2017-02-28