Incidental Mutation 'R0563:Dcdc5'
ID45997
Institutional Source Beutler Lab
Gene Symbol Dcdc5
Ensembl Gene ENSMUSG00000074981
Gene Namedoublecortin domain containing 5
SynonymsEG436559, 4732421G10Rik
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location106003336-106406151 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 106349690 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152776
Meta Mutation Damage Score 0.2293 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Dcdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0544:Dcdc5 UTSW 2 106351564 exon noncoding transcript
R1456:Dcdc5 UTSW 2 106351565 exon noncoding transcript
R1476:Dcdc5 UTSW 2 106358632 exon noncoding transcript
R1521:Dcdc5 UTSW 2 106351669 critical splice donor site noncoding transcript
R1555:Dcdc5 UTSW 2 106384135 exon noncoding transcript
R2280:Dcdc5 UTSW 2 106372522 critical splice donor site noncoding transcript
R2304:Dcdc5 UTSW 2 106336143 critical splice donor site noncoding transcript
R3775:Dcdc5 UTSW 2 106372393 exon noncoding transcript
R4820:Dcdc5 UTSW 2 106336075 exon noncoding transcript
R4874:Dcdc5 UTSW 2 106368106 exon noncoding transcript
R4910:Dcdc5 UTSW 2 106365550 exon noncoding transcript
R5285:Dcdc5 UTSW 2 106368155 exon noncoding transcript
R5583:Dcdc5 UTSW 2 106365433 exon noncoding transcript
R5634:Dcdc5 UTSW 2 106403980 exon noncoding transcript
R6313:Dcdc5 UTSW 2 106368171 critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACTCCATGACACTGCACTTTGGC -3'
(R):5'- TGGCACAACATTAAAACGTGATTGGAC -3'

Sequencing Primer
(F):5'- ACTGCACTTTGGCCGTTC -3'
(R):5'- CTTAATGAGAATGCATGGGGTTCAC -3'
Posted On2013-06-11