Incidental Mutation 'R5927:Kpna3'
ID459971
Institutional Source Beutler Lab
Gene Symbol Kpna3
Ensembl Gene ENSMUSG00000021929
Gene Namekaryopherin (importin) alpha 3
SynonymsIPOA4
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61365211-61439874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61384647 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 223 (V223I)
Ref Sequence ENSEMBL: ENSMUSP00000022496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022496]
Predicted Effect probably damaging
Transcript: ENSMUST00000022496
AA Change: V223I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022496
Gene: ENSMUSG00000021929
AA Change: V223I

DomainStartEndE-ValueType
Pfam:IBB 7 93 1e-25 PFAM
ARM 103 144 9.52e-11 SMART
ARM 146 186 2.15e-9 SMART
ARM 188 229 8.59e0 SMART
ARM 232 271 1.78e-1 SMART
ARM 273 313 4.31e-9 SMART
ARM 315 355 5.91e-7 SMART
ARM 357 397 5.22e-8 SMART
ARM 400 440 1.51e-4 SMART
Pfam:Arm_3 447 499 5.4e-25 PFAM
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Kpna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kpna3 APN 14 61374288 missense possibly damaging 0.94
IGL00321:Kpna3 APN 14 61391853 splice site probably benign
IGL01013:Kpna3 APN 14 61370517 missense probably damaging 1.00
IGL01833:Kpna3 APN 14 61370445 missense possibly damaging 0.92
IGL02661:Kpna3 APN 14 61372949 splice site probably benign
IGL03070:Kpna3 APN 14 61370782 splice site probably benign
R1428:Kpna3 UTSW 14 61383220 splice site probably benign
R1719:Kpna3 UTSW 14 61387477 missense probably damaging 1.00
R1728:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R1760:Kpna3 UTSW 14 61370541 missense probably benign 0.03
R1784:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R2107:Kpna3 UTSW 14 61370484 missense possibly damaging 0.52
R4184:Kpna3 UTSW 14 61368175 missense probably damaging 0.96
R4952:Kpna3 UTSW 14 61370389 missense probably damaging 1.00
R5081:Kpna3 UTSW 14 61391245 missense probably damaging 0.97
R5766:Kpna3 UTSW 14 61403014 missense probably benign 0.07
R5887:Kpna3 UTSW 14 61403012 missense probably benign 0.04
R7116:Kpna3 UTSW 14 61368186 missense probably benign 0.32
R7615:Kpna3 UTSW 14 61372962 missense possibly damaging 0.81
R7674:Kpna3 UTSW 14 61367637 missense probably benign
R7799:Kpna3 UTSW 14 61384733 missense probably damaging 1.00
R8115:Kpna3 UTSW 14 61370918 missense probably damaging 1.00
R8239:Kpna3 UTSW 14 61387470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACACTCAACTTTGACATATGGTGTG -3'
(R):5'- GCCATTGCACACATTTCAGAC -3'

Sequencing Primer
(F):5'- CTACAGATTGAGTTTCAGGACAGCC -3'
(R):5'- AGACTTTCTCATCCTGACTGTG -3'
Posted On2017-02-28