Mutagenetix > Incidental Mutations

Incidental Mutation 'R5927:Col22a1'

459975

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

044122-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5927 (G1)

Quality Score

182

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 72006966 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 114 (A114E)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159993
AA Change: A114E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: A114E

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadm	T	A	3: 153,939,108	I60F	probably damaging	Het
Ankrd26	A	G	6: 118,507,636		probably null	Het
Arhgdib	A	T	6: 136,924,138	W198R	probably damaging	Het
Atad5	T	A	11: 80,127,285	I1354N	probably damaging	Het
Ccdc146	T	A	5: 21,308,621	K500*	probably null	Het
Cdk11b	G	A	4: 155,648,240		probably benign	Het
Cmip	A	T	8: 117,257,309	T70S	possibly damaging	Het
Cpeb1	T	C	7: 81,361,680	D171G	possibly damaging	Het
Crebzf	C	T	7: 90,444,323		probably benign	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
D630036H23Rik	C	A	12: 36,381,672		probably benign	Het
Dnah5	A	T	15: 28,335,718	T2277S	probably benign	Het
Dysf	T	A	6: 84,207,212	F2083Y	probably damaging	Het
Elavl4	T	A	4: 110,290,243		probably benign	Het
Elp3	A	G	14: 65,582,177	Y111H	probably damaging	Het
Eps8l2	A	T	7: 141,356,346	Q243L	probably benign	Het
Eri2	C	A	7: 119,786,068	L403F	probably damaging	Het
Fgfr4	T	A	13: 55,166,887	N614K	probably damaging	Het
Gm5108	T	G	5: 67,976,871	I74S	unknown	Het
Gpn1	T	C	5: 31,500,891	F130L	probably damaging	Het
Gpr176	T	A	2: 118,373,040	I50F	probably benign	Het
Gramd1a	A	G	7: 31,139,821	S221P	probably benign	Het
Hivep3	A	G	4: 120,097,108	T874A	possibly damaging	Het
Igkv12-40	A	G	6: 69,879,399		noncoding transcript	Het
Itgb2	C	A	10: 77,546,034	P57T	probably damaging	Het
Kcmf1	T	A	6: 72,843,005	D286V	possibly damaging	Het
Kcnt1	T	A	2: 25,909,376		probably benign	Het
Kif15	A	G	9: 123,017,261	S76G	probably benign	Het
Kpna3	C	T	14: 61,384,647	V223I	probably damaging	Het
Krt80	A	G	15: 101,364,208		probably benign	Het
Lama4	A	G	10: 39,072,812	Y857C	probably damaging	Het
Lcorl	G	T	5: 45,725,424		probably benign	Het
Map4k3	A	G	17: 80,613,919	V528A	probably benign	Het
Mmp8	T	A	9: 7,563,202	N255K	possibly damaging	Het
Npat	A	T	9: 53,562,221	K438*	probably null	Het
Olfr1246	T	A	2: 89,591,100	N5I	possibly damaging	Het
P4htm	T	C	9: 108,597,383	Y61C	probably damaging	Het
Polr3h	G	T	15: 81,917,279		probably null	Het
Prlr	C	T	15: 10,322,446	T176I	probably benign	Het
Psme4	T	G	11: 30,804,294	F184V	possibly damaging	Het
Ptgfrn	A	T	3: 101,060,652	F542I	possibly damaging	Het
Rock1	T	C	18: 10,116,792	E448G	probably damaging	Het
Rpf1	A	T	3: 146,519,463		probably null	Het
Sectm1b	T	C	11: 121,055,674	I132V	probably benign	Het
Sestd1	T	A	2: 77,187,159	H688L	probably benign	Het
Sidt2	T	C	9: 45,944,454	Y530C	probably damaging	Het
Sin3a	A	T	9: 57,111,111	K938M	probably damaging	Het
Sin3b	C	A	8: 72,749,878	R647S	probably benign	Het
Slc16a14	T	C	1: 84,912,267	H439R	possibly damaging	Het
Stc1	T	C	14: 69,032,373	V134A	probably benign	Het
Stk11ip	G	A	1: 75,524,691	V24I	possibly damaging	Het
Tbx6	G	A	7: 126,784,853	A359T	possibly damaging	Het
Thra	G	A	11: 98,763,688	V295I	possibly damaging	Het
Tmem8	T	C	17: 26,121,998	Y692H	probably benign	Het
Tnr	T	C	1: 159,912,766	M1170T	probably damaging	Het
Tpcn2	T	A	7: 145,278,784	I112F	probably damaging	Het
Trdv2-2	T	C	14: 53,961,541	L96P	probably damaging	Het
Trim24	T	A	6: 37,958,569	W832R	probably damaging	Het
Usp4	T	G	9: 108,391,760	S891A	probably benign	Het
Vmn1r88	A	T	7: 13,178,513	R265S	probably benign	Het
Vmn2r118	A	G	17: 55,624,494	L60S	probably benign	Het
Wdr74	T	C	19: 8,739,833	C220R	possibly damaging	Het
Xpo1	A	T	11: 23,268,653		probably benign	Het
Xpo1	A	T	11: 23,268,656		probably benign	Het
Zfp850	C	A	7: 27,990,195	G196V	probably benign	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGGCAATCTCATCCAGTTCC -3'
(R):5'- ACGTCTTCTAGTGTGGGCAAG -3'

Sequencing Primer
(F):5'- CAGCAAAAATGCGGATGCC -3'
(R):5'- CTTCTAGTGTGGGCAAGGAGGAC -3'

Posted On

2017-02-28