Incidental Mutation 'R5927:Krt80'
ID459978
Institutional Source Beutler Lab
Gene Symbol Krt80
Ensembl Gene ENSMUSG00000037185
Gene Namekeratin 80
Synonyms1200016G03Rik, 2310041I20Rik, Kb20
MMRRC Submission 044122-MU
Accession Numbers

Genbank: NM_028770.2; Ensembl: ENSMUST00000077196

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101347444-101370162 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) A to G at 101364208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077196] [ENSMUST00000077196] [ENSMUST00000230831] [ENSMUST00000230831] [ENSMUST00000230909] [ENSMUST00000230909]
Predicted Effect probably benign
Transcript: ENSMUST00000077196
SMART Domains Protein: ENSMUSP00000076437
Gene: ENSMUSG00000037185

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 79 2.5e-12 PFAM
Filament 82 393 2.18e-113 SMART
low complexity region 419 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077196
SMART Domains Protein: ENSMUSP00000076437
Gene: ENSMUSG00000037185

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 79 2.5e-12 PFAM
Filament 82 393 2.18e-113 SMART
low complexity region 419 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230107
Predicted Effect probably benign
Transcript: ENSMUST00000230831
Predicted Effect probably benign
Transcript: ENSMUST00000230831
Predicted Effect probably benign
Transcript: ENSMUST00000230909
Predicted Effect probably benign
Transcript: ENSMUST00000230909
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene's expression profile shows that it encodes a type II epithelial keratin, although structurally the encoded protein is more like a type II hair keratin. This protein is involved in cell differentiation, localizing near desmosomal plaques in earlier stages of differentiation but then dispersing throughout the cytoplasm in terminally differentiating cells. The type II keratins are clustered in a region of chromosome 12q13. Two transcript variants encoding two different fully functional isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Krt80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Krt80 APN 15 101349998 missense possibly damaging 0.64
IGL03184:Krt80 APN 15 101352254 missense probably damaging 1.00
1mM(1):Krt80 UTSW 15 101364208 critical splice donor site probably null
R0394:Krt80 UTSW 15 101352299 missense probably damaging 0.97
R0520:Krt80 UTSW 15 101370017 missense probably benign 0.00
R1654:Krt80 UTSW 15 101351709 missense probably damaging 0.96
R2436:Krt80 UTSW 15 101359503 missense probably damaging 0.98
R4326:Krt80 UTSW 15 101352308 missense possibly damaging 0.52
R5292:Krt80 UTSW 15 101352185 missense probably damaging 1.00
R5783:Krt80 UTSW 15 101359479 critical splice donor site probably null
R6847:Krt80 UTSW 15 101358729 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTCAGTGTTATAGGTTCTTCCCATAC -3'
(R):5'- TCTTGCAGGTCCAAGCTCTG -3'

Sequencing Primer
(F):5'- ATAGGTTCTTCCCATACCTGCAG -3'
(R):5'- AACTGCTGGAGACCCGATG -3'
Posted On2017-02-28