Incidental Mutation 'R5927:Vmn2r118'
ID459980
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Namevomeronasal 2, receptor 118
SynonymsEG383258, Vmn2r119, EG668547
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location55592341-55624672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55624494 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 60 (L60S)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
Predicted Effect probably benign
Transcript: ENSMUST00000168440
AA Change: L60S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: L60S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55592996 missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55592714 missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55592348 missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55610423 missense possibly damaging 0.94
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAAAGATGATTGGACTCC -3'
(R):5'- GCACAACTCAGGCTTCAGAG -3'

Sequencing Primer
(F):5'- AGATGATTGGACTCCATGAAGTG -3'
(R):5'- CAACTCAGGCTTCAGAGTGACTG -3'
Posted On2017-02-28