Incidental Mutation 'R0563:Fhl5'
ID45999
Institutional Source Beutler Lab
Gene Symbol Fhl5
Ensembl Gene ENSMUSG00000028259
Gene Namefour and a half LIM domains 5
SynonymsACT, 1700027G07Rik
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0563 (G1)
Quality Score193
Status Validated
Chromosome4
Chromosomal Location25199908-25242876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25213610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 109 (I109L)
Ref Sequence ENSEMBL: ENSMUSP00000103839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]
Predicted Effect probably damaging
Transcript: ENSMUST00000029922
AA Change: I109L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: I109L

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108204
AA Change: I109L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: I109L

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Meta Mutation Damage Score 0.1746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Fhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Fhl5 APN 4 25207181 missense possibly damaging 0.95
IGL02194:Fhl5 APN 4 25211341 missense probably benign 0.01
IGL03172:Fhl5 APN 4 25211309 missense probably damaging 1.00
PIT4466001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
PIT4472001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0256:Fhl5 UTSW 4 25213624 missense probably benign
R0304:Fhl5 UTSW 4 25207241 missense probably benign 0.01
R0480:Fhl5 UTSW 4 25207101 nonsense probably null
R3418:Fhl5 UTSW 4 25211252 missense probably benign
R3926:Fhl5 UTSW 4 25214790 splice site probably benign
R4382:Fhl5 UTSW 4 25200118 missense probably benign 0.16
R5930:Fhl5 UTSW 4 25214756 missense probably benign 0.04
R6135:Fhl5 UTSW 4 25214716 nonsense probably null
R6927:Fhl5 UTSW 4 25213681 missense probably benign 0.14
R7147:Fhl5 UTSW 4 25213777 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTGATTATGCCCAAGGCAGG -3'
(R):5'- GCACTAGGTTCCCAAGAATGTCCC -3'

Sequencing Primer
(F):5'- AGTTCTGTCTCTGGCTCAACAAG -3'
(R):5'- GTCCCATCTTGTCTTAGAAAACAGC -3'
Posted On2013-06-11