Incidental Mutation 'R5928:Polr2b'
ID460000
Institutional Source Beutler Lab
Gene Symbol Polr2b
Ensembl Gene ENSMUSG00000029250
Gene Namepolymerase (RNA) II (DNA directed) polypeptide B
SynonymsRPB2
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77310147-77349324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77345342 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1057 (D1057G)
Ref Sequence ENSEMBL: ENSMUSP00000031167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000046746] [ENSMUST00000163898]
Predicted Effect probably damaging
Transcript: ENSMUST00000031167
AA Change: D1057G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250
AA Change: D1057G

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046746
SMART Domains Protein: ENSMUSP00000045057
Gene: ENSMUSG00000036256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 166 266 5.53e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150191
Predicted Effect probably benign
Transcript: ENSMUST00000163898
SMART Domains Protein: ENSMUSP00000128318
Gene: ENSMUSG00000036256

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IB 30 113 9.23e-19 SMART
KAZAL 110 156 6.39e-12 SMART
IG 197 297 5.53e-6 SMART
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase that catalyzes the transcription of DNA into precursors of mRNA, snRNA and microRNA. This subunit and the largest subunit form opposite sides of the center cleft of Pol II. Deletion of the flap loop region of this subunit results in a decrease in the rate of transcriptional elongation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Polr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Polr2b APN 5 77332252 missense probably benign
IGL02069:Polr2b APN 5 77343197 missense probably benign 0.01
IGL03218:Polr2b APN 5 77315917 missense probably benign 0.03
R0007:Polr2b UTSW 5 77340437 missense probably benign 0.02
R0056:Polr2b UTSW 5 77334535 missense possibly damaging 0.55
R0076:Polr2b UTSW 5 77326561 missense possibly damaging 0.78
R0099:Polr2b UTSW 5 77320950 splice site probably benign
R0114:Polr2b UTSW 5 77343263 missense probably damaging 1.00
R0193:Polr2b UTSW 5 77320076 missense probably damaging 1.00
R0481:Polr2b UTSW 5 77332082 missense possibly damaging 0.90
R0607:Polr2b UTSW 5 77313159 unclassified probably benign
R1233:Polr2b UTSW 5 77334565 missense probably benign
R1597:Polr2b UTSW 5 77326101 missense probably damaging 1.00
R1674:Polr2b UTSW 5 77326623 missense possibly damaging 0.83
R1696:Polr2b UTSW 5 77342648 missense probably benign 0.12
R1704:Polr2b UTSW 5 77342560 missense possibly damaging 0.95
R1871:Polr2b UTSW 5 77326527 splice site probably benign
R2114:Polr2b UTSW 5 77320970 missense probably damaging 1.00
R2137:Polr2b UTSW 5 77320346 missense probably benign 0.18
R2305:Polr2b UTSW 5 77320437 splice site probably benign
R3921:Polr2b UTSW 5 77326653 missense probably damaging 1.00
R4027:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4031:Polr2b UTSW 5 77348405 missense possibly damaging 0.88
R4526:Polr2b UTSW 5 77326714 missense probably damaging 1.00
R4750:Polr2b UTSW 5 77332039 missense possibly damaging 0.92
R4827:Polr2b UTSW 5 77342551 missense probably benign
R5244:Polr2b UTSW 5 77343000 intron probably benign
R5360:Polr2b UTSW 5 77349146 missense possibly damaging 0.90
R5628:Polr2b UTSW 5 77313216 missense probably damaging 0.98
R6009:Polr2b UTSW 5 77320252 missense probably benign
R6179:Polr2b UTSW 5 77320977 missense probably damaging 1.00
R6251:Polr2b UTSW 5 77348294 missense probably benign 0.00
R7209:Polr2b UTSW 5 77343179 missense probably damaging 1.00
R7303:Polr2b UTSW 5 77321021 missense probably benign 0.04
R7328:Polr2b UTSW 5 77315999 missense probably damaging 1.00
R7345:Polr2b UTSW 5 77349119 missense possibly damaging 0.55
R7471:Polr2b UTSW 5 77321066 nonsense probably null
X0054:Polr2b UTSW 5 77348305 missense probably damaging 0.97
Z1088:Polr2b UTSW 5 77342722 missense possibly damaging 0.95
Z1088:Polr2b UTSW 5 77345401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGAGTATGTGCATATGCGTTTC -3'
(R):5'- TTCACAGCCCTGACCTGAAAG -3'

Sequencing Primer
(F):5'- TGCATATGCGTTTCTAAACTTGG -3'
(R):5'- CAGGAACACAGGCGGTCATC -3'
Posted On2017-02-28