Incidental Mutation 'R5928:Sorbs2'
ID 460012
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Name sorbin and SH3 domain containing 2
Synonyms 2010203O03Rik, 9430041O17Rik
MMRRC Submission 044123-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5928 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 45960825-46280943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46216220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 187 (I187V)
Ref Sequence ENSEMBL: ENSMUSP00000128000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000124544] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000134675] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000141039] [ENSMUST00000143820] [ENSMUST00000171337] [ENSMUST00000153798] [ENSMUST00000211095] [ENSMUST00000210946] [ENSMUST00000149752] [ENSMUST00000150102] [ENSMUST00000139103]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067107
AA Change: I187V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: I187V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124544
AA Change: I133V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000125295
AA Change: I26V
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: I26V

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130011
AA Change: I133V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626
AA Change: I133V

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132139
AA Change: I164V

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626
AA Change: I164V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect probably benign
Transcript: ENSMUST00000134675
AA Change: I164V

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118160
Gene: ENSMUSG00000031626
AA Change: I164V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably damaging
Transcript: ENSMUST00000135336
AA Change: I187V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: I187V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138049
AA Change: I187V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626
AA Change: I187V

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139869
AA Change: I156V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626
AA Change: I156V

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141039
AA Change: I164V

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117544
Gene: ENSMUSG00000031626
AA Change: I164V

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143820
AA Change: I133V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119539
Gene: ENSMUSG00000031626
AA Change: I133V

DomainStartEndE-ValueType
Sorb 113 163 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171337
AA Change: I187V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: I187V

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153798
AA Change: I156V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626
AA Change: I156V

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect probably benign
Transcript: ENSMUST00000210946
Predicted Effect probably benign
Transcript: ENSMUST00000149752
Predicted Effect probably benign
Transcript: ENSMUST00000150102
Predicted Effect probably benign
Transcript: ENSMUST00000139103
Meta Mutation Damage Score 0.3346 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,537,159 (GRCm39) I475L probably benign Het
Abcc2 C T 19: 43,807,797 (GRCm39) R813W probably damaging Het
Adam34 T C 8: 44,105,067 (GRCm39) T193A probably benign Het
Adgb T C 10: 10,254,531 (GRCm39) D1118G probably damaging Het
Adprh A C 16: 38,267,746 (GRCm39) S180A probably benign Het
Atad5 A T 11: 79,985,003 (GRCm39) D30V probably damaging Het
Best3 G A 10: 116,843,532 (GRCm39) D303N probably damaging Het
Bmp2k G C 5: 97,235,595 (GRCm39) probably benign Het
Btc A T 5: 91,514,004 (GRCm39) V86E probably damaging Het
Cacna2d4 G T 6: 119,258,659 (GRCm39) A582S probably benign Het
Carm1 A G 9: 21,486,598 (GRCm39) probably benign Het
Catsperg1 A T 7: 28,906,040 (GRCm39) S180T probably damaging Het
Ccdc185 A T 1: 182,575,047 (GRCm39) H547Q probably benign Het
Ccl6 A G 11: 83,479,658 (GRCm39) I115T possibly damaging Het
Cd44 C T 2: 102,654,648 (GRCm39) V470M probably damaging Het
Cdc25a T C 9: 109,718,861 (GRCm39) V354A probably damaging Het
Cdhr2 C A 13: 54,881,832 (GRCm39) Q1122K probably benign Het
Cep290 A G 10: 100,387,692 (GRCm39) K1958E probably damaging Het
Cfap53 C T 18: 74,492,811 (GRCm39) P512S possibly damaging Het
Chrdl2 A T 7: 99,659,200 (GRCm39) probably benign Het
Cibar1 A G 4: 12,171,919 (GRCm39) probably benign Het
Clec7a A T 6: 129,442,430 (GRCm39) F199Y probably damaging Het
Cracd A C 5: 76,989,581 (GRCm39) probably benign Het
Dhx29 A G 13: 113,101,002 (GRCm39) K1182E probably benign Het
Dnah11 G T 12: 117,878,371 (GRCm39) probably null Het
Dnmt3a A G 12: 3,916,096 (GRCm39) S94G possibly damaging Het
Ecpas A T 4: 58,849,948 (GRCm39) M425K possibly damaging Het
Egfem1 T C 3: 29,637,077 (GRCm39) V42A possibly damaging Het
Eif3e T A 15: 43,138,728 (GRCm39) probably null Het
Exosc9 T A 3: 36,609,774 (GRCm39) probably benign Het
Fbxw18 T A 9: 109,529,149 (GRCm39) T135S probably damaging Het
Fbxw21 T C 9: 108,972,893 (GRCm39) E347G possibly damaging Het
Gcm2 A G 13: 41,256,874 (GRCm39) Y292H probably benign Het
Gltpd2 C A 11: 70,410,179 (GRCm39) Q46K probably benign Het
Gm6741 A G 17: 91,544,528 (GRCm39) Y97C probably damaging Het
Golgb1 T C 16: 36,732,349 (GRCm39) L532S probably damaging Het
Hdac3 C T 18: 38,074,394 (GRCm39) probably benign Het
Helz2 A T 2: 180,872,177 (GRCm39) F2554L possibly damaging Het
Hmbox1 T A 14: 65,061,122 (GRCm39) H384L possibly damaging Het
Hmcn1 G T 1: 150,474,648 (GRCm39) D4746E possibly damaging Het
Il17rb C A 14: 29,726,232 (GRCm39) probably null Het
Irak2 A T 6: 113,653,587 (GRCm39) I252F probably damaging Het
Khnyn C T 14: 56,123,344 (GRCm39) R33C probably damaging Het
Ksr1 G A 11: 78,950,545 (GRCm39) P20L probably damaging Het
Lamc3 T C 2: 31,811,721 (GRCm39) Y903H probably benign Het
Miga2 T C 2: 30,258,875 (GRCm39) probably benign Het
Mroh2a A C 1: 88,169,340 (GRCm39) I672L probably benign Het
Ncoa4 T C 14: 31,888,678 (GRCm39) probably null Het
Nphp3 T C 9: 103,912,996 (GRCm39) Y925H probably benign Het
Nr2c1 T G 10: 94,024,055 (GRCm39) L420R probably damaging Het
Onecut1 A G 9: 74,770,066 (GRCm39) N163S probably benign Het
Or5ac21 G A 16: 59,123,521 (GRCm39) E2K probably damaging Het
Or5d47 T A 2: 87,804,380 (GRCm39) S210C probably benign Het
Or7e166 A T 9: 19,625,049 (GRCm39) T309S probably benign Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Per2 C T 1: 91,372,373 (GRCm39) V234I probably damaging Het
Pign A G 1: 105,485,792 (GRCm39) V735A possibly damaging Het
Plekha7 T C 7: 115,727,809 (GRCm39) K85R probably benign Het
Pnma2 C T 14: 67,154,323 (GRCm39) T249I probably benign Het
Polr2b A G 5: 77,493,189 (GRCm39) D1057G probably damaging Het
Polrmt A T 10: 79,576,186 (GRCm39) L519H probably damaging Het
Ptar1 T C 19: 23,695,277 (GRCm39) I248T probably benign Het
Ptprh A C 7: 4,576,507 (GRCm39) L251R probably damaging Het
Purg T C 8: 33,876,980 (GRCm39) M206T probably benign Het
Pwp2 A T 10: 78,018,290 (GRCm39) F134I probably damaging Het
Riok3 T A 18: 12,286,075 (GRCm39) H434Q probably benign Het
Tbc1d2b T C 9: 90,101,197 (GRCm39) I598V probably benign Het
Tdg T A 10: 82,477,204 (GRCm39) V85E probably benign Het
Tfb1m C T 17: 3,593,422 (GRCm39) V166I probably benign Het
Tmem163 A T 1: 127,419,383 (GRCm39) M274K probably damaging Het
Tpr T C 1: 150,303,878 (GRCm39) I1343T probably benign Het
Ttn T A 2: 76,719,794 (GRCm39) probably benign Het
Tut7 G A 13: 59,969,880 (GRCm39) A5V probably benign Het
Usp34 A G 11: 23,386,040 (GRCm39) T2156A probably damaging Het
Vmn1r215 A T 13: 23,260,487 (GRCm39) T176S possibly damaging Het
Vps52 C T 17: 34,180,100 (GRCm39) P268L possibly damaging Het
Xbp1 G A 11: 5,473,514 (GRCm39) probably benign Het
Ythdc2 T A 18: 44,966,272 (GRCm39) F169L probably benign Het
Zfyve16 T C 13: 92,658,625 (GRCm39) R429G probably benign Het
Zzef1 A G 11: 72,803,678 (GRCm39) E2504G probably damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 46,252,743 (GRCm39) splice site probably null
IGL00964:Sorbs2 APN 8 46,248,714 (GRCm39) missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 46,198,460 (GRCm39) missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 46,248,631 (GRCm39) missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 46,248,381 (GRCm39) missense probably null
IGL01662:Sorbs2 APN 8 46,256,866 (GRCm39) splice site probably benign
IGL01970:Sorbs2 APN 8 46,198,840 (GRCm39) missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 46,276,786 (GRCm39) missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 46,256,877 (GRCm39) missense probably benign 0.00
IGL03036:Sorbs2 APN 8 46,235,902 (GRCm39) missense probably benign
IGL03151:Sorbs2 APN 8 46,252,750 (GRCm39) missense probably benign 0.01
IGL03164:Sorbs2 APN 8 46,235,911 (GRCm39) missense probably benign 0.01
IGL03350:Sorbs2 APN 8 46,258,844 (GRCm39) missense probably damaging 0.99
BB001:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
BB011:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,249,300 (GRCm39) missense probably damaging 1.00
R0058:Sorbs2 UTSW 8 46,238,291 (GRCm39) splice site probably null
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 46,238,374 (GRCm39) splice site probably benign
R0306:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R0308:Sorbs2 UTSW 8 46,248,167 (GRCm39) nonsense probably null
R0638:Sorbs2 UTSW 8 46,249,347 (GRCm39) missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 46,249,539 (GRCm39) missense probably benign 0.39
R1110:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.13
R1160:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 46,248,656 (GRCm39) missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 46,249,004 (GRCm39) missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 46,243,000 (GRCm39) splice site probably benign
R1514:Sorbs2 UTSW 8 46,222,866 (GRCm39) missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 46,212,234 (GRCm39) splice site probably benign
R1582:Sorbs2 UTSW 8 46,258,814 (GRCm39) missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 46,222,891 (GRCm39) missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 46,254,021 (GRCm39) missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 46,216,056 (GRCm39) makesense probably null
R1766:Sorbs2 UTSW 8 46,223,613 (GRCm39) missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 46,258,733 (GRCm39) missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 46,249,389 (GRCm39) missense probably benign 0.01
R1954:Sorbs2 UTSW 8 46,198,775 (GRCm39) missense probably benign 0.23
R2060:Sorbs2 UTSW 8 46,228,666 (GRCm39) missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 46,248,480 (GRCm39) missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 46,248,407 (GRCm39) nonsense probably null
R3812:Sorbs2 UTSW 8 46,216,067 (GRCm39) missense probably benign 0.00
R3831:Sorbs2 UTSW 8 46,248,132 (GRCm39) missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 46,225,747 (GRCm39) critical splice donor site probably null
R4033:Sorbs2 UTSW 8 46,228,632 (GRCm39) missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 46,248,330 (GRCm39) missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 46,194,652 (GRCm39) intron probably benign
R4926:Sorbs2 UTSW 8 46,249,254 (GRCm39) missense probably benign 0.03
R5027:Sorbs2 UTSW 8 46,199,571 (GRCm39) splice site probably null
R5118:Sorbs2 UTSW 8 46,248,822 (GRCm39) missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 46,248,767 (GRCm39) missense probably benign 0.00
R5342:Sorbs2 UTSW 8 46,249,050 (GRCm39) missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 46,272,778 (GRCm39) missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 46,249,038 (GRCm39) missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 46,194,618 (GRCm39) critical splice donor site probably null
R5687:Sorbs2 UTSW 8 46,228,669 (GRCm39) missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 46,245,912 (GRCm39) missense probably benign 0.27
R5733:Sorbs2 UTSW 8 46,212,226 (GRCm39) missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 46,222,934 (GRCm39) critical splice donor site probably null
R6341:Sorbs2 UTSW 8 46,223,615 (GRCm39) missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 46,249,213 (GRCm39) missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 46,225,651 (GRCm39) missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 46,248,860 (GRCm39) nonsense probably null
R7404:Sorbs2 UTSW 8 46,212,233 (GRCm39) splice site probably null
R7524:Sorbs2 UTSW 8 46,248,693 (GRCm39) missense probably benign 0.00
R7809:Sorbs2 UTSW 8 46,198,465 (GRCm39) missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 46,249,593 (GRCm39) missense probably null 0.16
R7924:Sorbs2 UTSW 8 46,248,507 (GRCm39) missense probably damaging 1.00
R8285:Sorbs2 UTSW 8 46,249,104 (GRCm39) missense probably damaging 0.98
R8696:Sorbs2 UTSW 8 46,248,686 (GRCm39) missense possibly damaging 0.95
R8927:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R8928:Sorbs2 UTSW 8 46,248,952 (GRCm39) missense probably damaging 1.00
R9005:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9006:Sorbs2 UTSW 8 46,258,858 (GRCm39) missense possibly damaging 0.95
R9016:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9017:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9091:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9196:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9256:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9282:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9283:Sorbs2 UTSW 8 46,248,774 (GRCm39) missense probably benign
R9384:Sorbs2 UTSW 8 46,258,864 (GRCm39) missense probably benign 0.12
R9624:Sorbs2 UTSW 8 46,228,690 (GRCm39) missense possibly damaging 0.89
R9664:Sorbs2 UTSW 8 46,276,788 (GRCm39) missense probably benign 0.05
Z1176:Sorbs2 UTSW 8 46,243,062 (GRCm39) missense probably null 0.96
Z1177:Sorbs2 UTSW 8 46,235,996 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCATTAGTTTATACCCAATGTG -3'
(R):5'- GATTATCTTCACCGCCCAGC -3'

Sequencing Primer
(F):5'- AGTTTATACCCAATGTGTTCCCTG -3'
(R):5'- CCCTCTGCCACACAGCG -3'
Posted On 2017-02-28