Incidental Mutation 'R5928:Polrmt'
ID460023
Institutional Source Beutler Lab
Gene Symbol Polrmt
Ensembl Gene ENSMUSG00000020329
Gene Namepolymerase (RNA) mitochondrial (DNA directed)
Synonyms
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5928 (G1)
Quality Score126
Status Validated
Chromosome10
Chromosomal Location79736123-79746581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79740352 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 519 (L519H)
Ref Sequence ENSEMBL: ENSMUSP00000124556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000020581] [ENSMUST00000099513] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably damaging
Transcript: ENSMUST00000020580
AA Change: L519H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329
AA Change: L519H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020581
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099513
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159016
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161375
Predicted Effect probably benign
Transcript: ENSMUST00000161662
SMART Domains Protein: ENSMUSP00000124230
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
Pfam:RNA_pol 29 120 6.7e-39 PFAM
Pfam:RNA_pol 119 393 2.7e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162687
Predicted Effect probably damaging
Transcript: ENSMUST00000162694
AA Change: L519H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329
AA Change: L519H

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die before organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Polrmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Polrmt APN 10 79737597 splice site probably null
IGL01145:Polrmt APN 10 79741137 missense probably benign 0.12
IGL01454:Polrmt APN 10 79743683 missense possibly damaging 0.60
IGL01511:Polrmt APN 10 79740151 missense probably benign 0.00
IGL01750:Polrmt APN 10 79739846 missense possibly damaging 0.84
IGL01766:Polrmt APN 10 79736568 missense possibly damaging 0.71
IGL01827:Polrmt APN 10 79738120 missense probably damaging 1.00
IGL02941:Polrmt APN 10 79737258 splice site probably benign
IGL02982:Polrmt APN 10 79738348 missense probably damaging 1.00
R0323:Polrmt UTSW 10 79741998 missense probably benign 0.41
R0379:Polrmt UTSW 10 79737611 missense possibly damaging 0.89
R0628:Polrmt UTSW 10 79739145 missense possibly damaging 0.89
R1017:Polrmt UTSW 10 79743509 nonsense probably null
R1846:Polrmt UTSW 10 79738209 missense probably damaging 1.00
R2082:Polrmt UTSW 10 79743512 missense probably benign 0.41
R2149:Polrmt UTSW 10 79740275 nonsense probably null
R2359:Polrmt UTSW 10 79736562 missense probably damaging 1.00
R4105:Polrmt UTSW 10 79741733 missense probably benign
R4381:Polrmt UTSW 10 79741808 missense possibly damaging 0.94
R4782:Polrmt UTSW 10 79739523 missense probably benign 0.04
R4902:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4904:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4916:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4938:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4963:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4964:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4970:Polrmt UTSW 10 79736587 missense probably damaging 1.00
R5177:Polrmt UTSW 10 79737476 missense probably benign 0.04
R5484:Polrmt UTSW 10 79742054 missense probably damaging 1.00
R5820:Polrmt UTSW 10 79738323 splice site probably null
R5910:Polrmt UTSW 10 79743497 missense probably benign 0.03
R6550:Polrmt UTSW 10 79739680 missense probably damaging 1.00
R6979:Polrmt UTSW 10 79746566 utr 5 prime probably null
R7233:Polrmt UTSW 10 79745785 splice site probably null
R7323:Polrmt UTSW 10 79740649 missense probably benign
R7505:Polrmt UTSW 10 79737883 missense probably benign 0.18
R7505:Polrmt UTSW 10 79743176 critical splice donor site probably null
X0026:Polrmt UTSW 10 79740740 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACATGGTAAAGCACTGGGATG -3'
(R):5'- GGTAACGTGGGATGGACTTC -3'

Sequencing Primer
(F):5'- ACTGGGATGGAGCGCTG -3'
(R):5'- GATGGACTTCTGGTGACCC -3'
Posted On2017-02-28