Incidental Mutation 'R5928:Tdg'
ID460024
Institutional Source Beutler Lab
Gene Symbol Tdg
Ensembl Gene ENSMUSG00000034674
Gene Namethymine DNA glycosylase
SynonymsE130317C12Rik, Jza1
MMRRC Submission 044123-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5928 (G1)
Quality Score210
Status Validated
Chromosome10
Chromosomal Location82629828-82650799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82641370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 85 (V85E)
Ref Sequence ENSEMBL: ENSMUSP00000121000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092266] [ENSMUST00000145370] [ENSMUST00000151390] [ENSMUST00000177353]
Predicted Effect probably benign
Transcript: ENSMUST00000092266
AA Change: V61E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000089917
Gene: ENSMUSG00000034674
AA Change: V61E

DomainStartEndE-ValueType
internal_repeat_1 3 21 1.82e-5 PROSPERO
internal_repeat_1 18 36 1.82e-5 PROSPERO
low complexity region 39 57 N/A INTRINSIC
low complexity region 63 84 N/A INTRINSIC
UDG 112 278 2.03e0 SMART
UreE_C 112 278 2.03e0 SMART
low complexity region 324 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135652
Predicted Effect probably benign
Transcript: ENSMUST00000145370
AA Change: V61E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116707
Gene: ENSMUSG00000034674
AA Change: V61E

DomainStartEndE-ValueType
internal_repeat_1 3 21 3.42e-6 PROSPERO
internal_repeat_1 18 36 3.42e-6 PROSPERO
low complexity region 39 57 N/A INTRINSIC
low complexity region 63 84 N/A INTRINSIC
Pfam:UDG 112 186 9.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148790
Predicted Effect probably benign
Transcript: ENSMUST00000151390
AA Change: V85E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121000
Gene: ENSMUSG00000034674
AA Change: V85E

DomainStartEndE-ValueType
internal_repeat_1 23 45 8.83e-7 PROSPERO
internal_repeat_1 38 60 8.83e-7 PROSPERO
low complexity region 63 81 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
UDG 136 302 1.6e-4 SMART
UreE_C 136 302 1.6e-4 SMART
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176195
Predicted Effect probably benign
Transcript: ENSMUST00000176326
SMART Domains Protein: ENSMUSP00000135009
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
Blast:UreE_C 2 78 9e-50 BLAST
SCOP:d1muga_ 2 83 2e-10 SMART
PDB:2D07|A 2 123 9e-85 PDB
low complexity region 124 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177353
SMART Domains Protein: ENSMUSP00000135621
Gene: ENSMUSG00000034674

DomainStartEndE-ValueType
UDG 28 185 9.44e0 SMART
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during organogenesis, abnormal DNA methylation, and abnormal heart, vascular, and limb development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Tpr T C 1: 150,428,127 I1343T probably benign Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Tdg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1930:Tdg UTSW 10 82641544 missense probably damaging 1.00
R2062:Tdg UTSW 10 82641534 missense probably benign 0.44
R5378:Tdg UTSW 10 82641471 missense probably benign 0.06
R6367:Tdg UTSW 10 82647988 missense possibly damaging 0.56
R7008:Tdg UTSW 10 82648641 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ATCAAATGTGCCTAGGTGGGG -3'
(R):5'- TCTGTCGTCAAACAAGGAGG -3'

Sequencing Primer
(F):5'- TGCCTAGGTGGGGAGAGG -3'
(R):5'- GCCTTACGATCACAATATCCAGATTG -3'
Posted On2017-02-28