Mutagenetix > Incidental Mutation

Incidental Mutation 'R5928:Dhx29'

460042

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

044123-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112964468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1182 (K1182E)

Ref Sequence

ENSEMBL: ENSMUSP00000035244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574]

AlphaFold

Q6PGC1

Predicted Effect

probably benign
Transcript: ENSMUST00000038574
AA Change: K1182E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: K1182E

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Meta Mutation Damage Score

0.0706

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

97% (90/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	A	17: 24,318,185	I475L	probably benign	Het
Abcc2	C	T	19: 43,819,358	R813W	probably damaging	Het
Adam34	T	C	8: 43,652,030	T193A	probably benign	Het
Adgb	T	C	10: 10,378,787	D1118G	probably damaging	Het
Adprh	A	C	16: 38,447,384	S180A	probably benign	Het
AI314180	A	T	4: 58,849,948	M425K	possibly damaging	Het
Atad5	A	T	11: 80,094,177	D30V	probably damaging	Het
Best3	G	A	10: 117,007,627	D303N	probably damaging	Het
Bmp2k	G	C	5: 97,087,736		probably benign	Het
Btc	A	T	5: 91,366,145	V86E	probably damaging	Het
C530008M17Rik	A	C	5: 76,841,734		probably benign	Het
Cacna2d4	G	T	6: 119,281,698	A582S	probably benign	Het
Carm1	A	G	9: 21,575,302		probably benign	Het
Catsperg1	A	T	7: 29,206,615	S180T	probably damaging	Het
Ccdc185	A	T	1: 182,747,482	H547Q	probably benign	Het
Ccl6	A	G	11: 83,588,832	I115T	possibly damaging	Het
Cd44	C	T	2: 102,824,303	V470M	probably damaging	Het
Cdc25a	T	C	9: 109,889,793	V354A	probably damaging	Het
Cdhr2	C	A	13: 54,734,019	Q1122K	probably benign	Het
Cep290	A	G	10: 100,551,830	K1958E	probably damaging	Het
Cfap53	C	T	18: 74,359,740	P512S	possibly damaging	Het
Chrdl2	A	T	7: 100,009,993		probably benign	Het
Clec7a	A	T	6: 129,465,467	F199Y	probably damaging	Het
Dnah11	G	T	12: 117,914,636		probably null	Het
Dnmt3a	A	G	12: 3,866,096	S94G	possibly damaging	Het
Egfem1	T	C	3: 29,582,928	V42A	possibly damaging	Het
Eif3e	T	A	15: 43,275,332		probably null	Het
Exosc9	T	A	3: 36,555,625		probably benign	Het
Fam92a	A	G	4: 12,171,919		probably benign	Het
Fbxw18	T	A	9: 109,700,081	T135S	probably damaging	Het
Fbxw21	T	C	9: 109,143,825	E347G	possibly damaging	Het
Gcm2	A	G	13: 41,103,398	Y292H	probably benign	Het
Gltpd2	C	A	11: 70,519,353	Q46K	probably benign	Het
Gm6741	A	G	17: 91,237,100	Y97C	probably damaging	Het
Golgb1	T	C	16: 36,911,987	L532S	probably damaging	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Helz2	A	T	2: 181,230,384	F2554L	possibly damaging	Het
Hmbox1	T	A	14: 64,823,673	H384L	possibly damaging	Het
Hmcn1	G	T	1: 150,598,897	D4746E	possibly damaging	Het
Il17rb	C	A	14: 30,004,275		probably null	Het
Irak2	A	T	6: 113,676,626	I252F	probably damaging	Het
Khnyn	C	T	14: 55,885,887	R33C	probably damaging	Het
Ksr1	G	A	11: 79,059,719	P20L	probably damaging	Het
Lamc3	T	C	2: 31,921,709	Y903H	probably benign	Het
Miga2	T	C	2: 30,368,863		probably benign	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Ncoa4	T	C	14: 32,166,721		probably null	Het
Nphp3	T	C	9: 104,035,797	Y925H	probably benign	Het
Nr2c1	T	G	10: 94,188,193	L420R	probably damaging	Het
Olfr203	G	A	16: 59,303,158	E2K	probably damaging	Het
Olfr74	T	A	2: 87,974,036	S210C	probably benign	Het
Olfr857	A	T	9: 19,713,753	T309S	probably benign	Het
Onecut1	A	G	9: 74,862,784	N163S	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Per2	C	T	1: 91,444,651	V234I	probably damaging	Het
Pign	A	G	1: 105,558,067	V735A	possibly damaging	Het
Plekha7	T	C	7: 116,128,574	K85R	probably benign	Het
Pnma2	C	T	14: 66,916,874	T249I	probably benign	Het
Polr2b	A	G	5: 77,345,342	D1057G	probably damaging	Het
Polrmt	A	T	10: 79,740,352	L519H	probably damaging	Het
Ptar1	T	C	19: 23,717,913	I248T	probably benign	Het
Ptprh	A	C	7: 4,573,508	L251R	probably damaging	Het
Purg	T	C	8: 33,386,952	M206T	probably benign	Het
Pwp2	A	T	10: 78,182,456	F134I	probably damaging	Het
Riok3	T	A	18: 12,153,018	H434Q	probably benign	Het
Sorbs2	A	G	8: 45,763,183	I187V	probably damaging	Het
Tbc1d2b	T	C	9: 90,219,144	I598V	probably benign	Het
Tdg	T	A	10: 82,641,370	V85E	probably benign	Het
Tfb1m	C	T	17: 3,543,147	V166I	probably benign	Het
Tmem163	A	T	1: 127,491,646	M274K	probably damaging	Het
Tpr	T	C	1: 150,428,127	I1343T	probably benign	Het
Ttn	T	A	2: 76,889,450		probably benign	Het
Usp34	A	G	11: 23,436,040	T2156A	probably damaging	Het
Vmn1r215	A	T	13: 23,076,317	T176S	possibly damaging	Het
Vps52	C	T	17: 33,961,126	P268L	possibly damaging	Het
Xbp1	G	A	11: 5,523,514		probably benign	Het
Ythdc2	T	A	18: 44,833,205	F169L	probably benign	Het
Zcchc6	G	A	13: 59,822,066	A5V	probably benign	Het
Zfyve16	T	C	13: 92,522,117	R429G	probably benign	Het
Zzef1	A	G	11: 72,912,852	E2504G	probably damaging	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	112952843	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2679:Dhx29	UTSW	13	112947376	critical splice donor site	probably null
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5125:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	112940374	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7555:Dhx29	UTSW	13	112927642	start gained	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
R8744:Dhx29	UTSW	13	112952884	missense	possibly damaging	0.54
R9281:Dhx29	UTSW	13	112941706	missense	possibly damaging	0.82
R9450:Dhx29	UTSW	13	112947328	missense	possibly damaging	0.78
R9496:Dhx29	UTSW	13	112952926	missense	probably damaging	1.00
R9716:Dhx29	UTSW	13	112945078	missense	possibly damaging	0.83
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCACTGTTCTAGGTGCTAATCC -3'
(R):5'- TGCACCTGAGCTTTGCCTTG -3'

Sequencing Primer
(F):5'- GGTGCTAATCCTTCACTTCCCAGAG -3'
(R):5'- TGGGCTGTCTCCACCATG -3'

Posted On

2017-02-28