Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Rims1'

460062

Institutional Source

Beutler Lab

Gene Symbol

Rims1

Ensembl Gene

ENSMUSG00000041670

Gene Name

regulating synaptic membrane exocytosis 1

Synonyms

RIM1a, RIM1, RIM1alpha, C030033M19Rik

MMRRC Submission

044124-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.620) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22286251-22805994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22468241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 609 (D609E)

Ref Sequence

ENSEMBL: ENSMUSP00000110928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081544] [ENSMUST00000097808] [ENSMUST00000097809] [ENSMUST00000097810] [ENSMUST00000097811] [ENSMUST00000115273]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081544
AA Change: D609E

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080259
Gene: ENSMUSG00000041670
AA Change: D609E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC
C2	1120	1223	7.45e-15	SMART
low complexity region	1245	1253	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097808
AA Change: D787E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000095417
Gene: ENSMUSG00000041670
AA Change: D787E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	3.3e-10	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097809
AA Change: D609E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095418
Gene: ENSMUSG00000041670
AA Change: D609E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	974	1009	N/A	INTRINSIC
low complexity region	1086	1100	N/A	INTRINSIC
C2	1195	1298	7.45e-15	SMART
low complexity region	1320	1328	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097810
AA Change: D609E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095419
Gene: ENSMUSG00000041670
AA Change: D609E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
PDB:2CJS\|C	131	193	2e-32	PDB
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	862	874	N/A	INTRINSIC
low complexity region	916	929	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC
C2	1256	1359	7.45e-15	SMART
low complexity region	1381	1389	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097811
AA Change: D609E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095420
Gene: ENSMUSG00000041670
AA Change: D609E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	1.6e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	867	881	N/A	INTRINSIC
low complexity region	944	957	N/A	INTRINSIC
low complexity region	1063	1098	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC
C2	1284	1387	7.45e-15	SMART
low complexity region	1409	1417	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115273
AA Change: D609E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110928
Gene: ENSMUSG00000041670
AA Change: D609E

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
coiled coil region	30	52	N/A	INTRINSIC
Pfam:FYVE_2	102	205	2.8e-9	PFAM
low complexity region	283	293	N/A	INTRINSIC
low complexity region	329	345	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
PDZ	449	528	1.44e-15	SMART
low complexity region	535	551	N/A	INTRINSIC
C2	593	703	7.55e-1	SMART
low complexity region	710	721	N/A	INTRINSIC
low complexity region	950	985	N/A	INTRINSIC
low complexity region	1062	1076	N/A	INTRINSIC
C2	1171	1274	7.45e-15	SMART
low complexity region	1296	1304	N/A	INTRINSIC

Meta Mutation Damage Score

0.0783

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RAS gene superfamily member that regulates synaptic vesicle exocytosis. This gene also plays a role in the regulation of voltage-gated calcium channels during neurotransmitter and insulin release. Mutations have suggested a role cognition and have been identified as the cause of cone-rod dystrophy type 7. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in maternal care and abnormalities in synaptic transmission in the central nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Rims1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Rims1	APN	1	22468242	missense	probably damaging	1.00
IGL00535:Rims1	APN	1	22432921	missense	probably benign	0.02
IGL01021:Rims1	APN	1	22486620	missense	probably damaging	1.00
IGL01106:Rims1	APN	1	22379447	missense	probably damaging	1.00
IGL01128:Rims1	APN	1	22534175	missense	probably damaging	0.97
IGL01548:Rims1	APN	1	22538602	missense	probably damaging	1.00
IGL01688:Rims1	APN	1	22397540	missense	probably benign	0.22
IGL02089:Rims1	APN	1	22630475	missense	possibly damaging	0.68
IGL02245:Rims1	APN	1	22346488	missense	probably damaging	0.98
IGL02355:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02362:Rims1	APN	1	22483207	missense	probably damaging	1.00
IGL02682:Rims1	APN	1	22288484	missense	probably damaging	1.00
IGL03006:Rims1	APN	1	22296954	missense	probably damaging	0.99
IGL03054:Rims1	UTSW	1	22290109	missense	probably damaging	1.00
PIT4504001:Rims1	UTSW	1	22397460	missense
R0031:Rims1	UTSW	1	22296879	missense	probably damaging	1.00
R0118:Rims1	UTSW	1	22346407	missense	probably damaging	1.00
R0390:Rims1	UTSW	1	22596526	missense	possibly damaging	0.92
R0483:Rims1	UTSW	1	22468182	splice site	probably benign
R0744:Rims1	UTSW	1	22427459	splice site	probably null
R0836:Rims1	UTSW	1	22427459	splice site	probably null
R1218:Rims1	UTSW	1	22483175	missense	probably damaging	1.00
R1228:Rims1	UTSW	1	22472756	missense	probably null	1.00
R1374:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1474:Rims1	UTSW	1	22538281	splice site	probably benign
R1652:Rims1	UTSW	1	22292866	missense	probably damaging	1.00
R1712:Rims1	UTSW	1	22296948	missense	probably damaging	1.00
R1730:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1783:Rims1	UTSW	1	22346529	critical splice acceptor site	probably null
R1861:Rims1	UTSW	1	22596558	missense	probably damaging	1.00
R1899:Rims1	UTSW	1	22428474	missense	probably damaging	1.00
R1937:Rims1	UTSW	1	22288530	missense	probably damaging	1.00
R2010:Rims1	UTSW	1	22296996	missense	probably damaging	1.00
R2049:Rims1	UTSW	1	22596435	missense	probably damaging	1.00
R2124:Rims1	UTSW	1	22404508	nonsense	probably null
R2860:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2861:Rims1	UTSW	1	22432976	missense	probably benign	0.01
R2914:Rims1	UTSW	1	22805630	missense	probably damaging	1.00
R3740:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3741:Rims1	UTSW	1	22373443	missense	probably damaging	1.00
R3773:Rims1	UTSW	1	22421810	missense	probably damaging	1.00
R3874:Rims1	UTSW	1	22428489	missense	probably damaging	1.00
R3901:Rims1	UTSW	1	22533497	missense	probably benign	0.00
R3964:Rims1	UTSW	1	22427459	splice site	probably null
R4037:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4039:Rims1	UTSW	1	22475712	missense	probably damaging	0.96
R4056:Rims1	UTSW	1	22292939	splice site	probably benign
R4062:Rims1	UTSW	1	22533583	missense	probably benign	0.00
R4552:Rims1	UTSW	1	22373494	missense	probably damaging	0.99
R4658:Rims1	UTSW	1	22427543	missense	probably damaging	0.98
R4688:Rims1	UTSW	1	22479447	nonsense	probably null
R4696:Rims1	UTSW	1	22288612	missense	probably damaging	1.00
R4720:Rims1	UTSW	1	22427481	missense	probably damaging	1.00
R4764:Rims1	UTSW	1	22479462	missense	probably damaging	1.00
R4780:Rims1	UTSW	1	22291105	missense	probably damaging	1.00
R4931:Rims1	UTSW	1	22533947	missense	probably benign	0.26
R5137:Rims1	UTSW	1	22288620	nonsense	probably null
R5153:Rims1	UTSW	1	22483247	nonsense	probably null
R5305:Rims1	UTSW	1	22596542	missense	probably damaging	0.99
R5354:Rims1	UTSW	1	22538511	missense	probably damaging	1.00
R5386:Rims1	UTSW	1	22412245	missense	probably damaging	0.99
R5485:Rims1	UTSW	1	22483208	missense	possibly damaging	0.93
R5643:Rims1	UTSW	1	22538509	missense	probably damaging	1.00
R5988:Rims1	UTSW	1	22596463	missense	probably damaging	1.00
R6160:Rims1	UTSW	1	22432984	missense	probably damaging	0.98
R6579:Rims1	UTSW	1	22425916	missense	probably damaging	1.00
R6790:Rims1	UTSW	1	22468197	missense	probably damaging	1.00
R7048:Rims1	UTSW	1	22472820	missense	probably damaging	1.00
R7100:Rims1	UTSW	1	22346473	missense	probably benign	0.27
R7155:Rims1	UTSW	1	22432923	missense	probably damaging	0.99
R7171:Rims1	UTSW	1	22428489	missense
R7448:Rims1	UTSW	1	22404475	missense
R7505:Rims1	UTSW	1	22533996	missense	possibly damaging	0.55
R7567:Rims1	UTSW	1	22468210	missense	probably damaging	0.99
R7639:Rims1	UTSW	1	22805669	missense	probably benign	0.02
R7955:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
R8005:Rims1	UTSW	1	22412213	missense
R8071:Rims1	UTSW	1	22288536	nonsense	probably null
R8465:Rims1	UTSW	1	22428480	missense	possibly damaging	0.89
R8517:Rims1	UTSW	1	22483165	missense	probably damaging	1.00
R8703:Rims1	UTSW	1	22425887	missense
R8726:Rims1	UTSW	1	22594100	missense	possibly damaging	0.88
R9090:Rims1	UTSW	1	22428522	missense
R9179:Rims1	UTSW	1	22412266	missense	probably damaging	0.99
R9271:Rims1	UTSW	1	22428522	missense
R9291:Rims1	UTSW	1	22397522	missense
R9394:Rims1	UTSW	1	22472775	missense	probably damaging	1.00
R9578:Rims1	UTSW	1	22484742	missense	probably damaging	1.00
R9614:Rims1	UTSW	1	22421745	nonsense	probably null
R9726:Rims1	UTSW	1	22630412	missense	probably null	0.21
Z1088:Rims1	UTSW	1	22288586	missense	probably damaging	1.00
Z1176:Rims1	UTSW	1	22484671	nonsense	probably null
Z1177:Rims1	UTSW	1	22296939	missense	possibly damaging	0.93
Z1177:Rims1	UTSW	1	22468241	missense	probably damaging	1.00
Z1177:Rims1	UTSW	1	22472777	missense	probably benign	0.44
Z1177:Rims1	UTSW	1	22472804	missense	probably damaging	1.00
Z1186:Rims1	UTSW	1	22379482	missense

Predicted Primers

PCR Primer
(F):5'- TGTGGAATAATGCAGTTTGGTCCC -3'
(R):5'- ATGCTTCCAAATCACTGTAATTCCC -3'

Sequencing Primer
(F):5'- ATGCAGTTTGGTCCCCTAAATAC -3'
(R):5'- AATGATAACTCCTCCATTGGGGGC -3'

Posted On

2017-02-28