Incidental Mutation 'R5929:Cd244'
ID460067
Institutional Source Beutler Lab
Gene Symbol Cd244
Ensembl Gene ENSMUSG00000004709
Gene NameCD244 natural killer cell receptor 2B4
Synonyms2B4, C9.1, F730046O15Rik, Nmrk
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171559193-171609746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171559367 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 15 (R15W)
Ref Sequence ENSEMBL: ENSMUSP00000141898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004829] [ENSMUST00000194797]
Predicted Effect probably damaging
Transcript: ENSMUST00000004829
AA Change: R15W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709
AA Change: R15W

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194170
Predicted Effect probably damaging
Transcript: ENSMUST00000194797
AA Change: R15W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709
AA Change: R15W

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered natural killer (NK) cell cytolysis. Mice homozygous for an ENU-generated allele exhibit reduced 'missing-self' targets recognition and elimination and increased clearance of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Cd244
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cd244 APN 1 171574370 critical splice donor site probably null
IGL01014:Cd244 APN 1 171574288 missense probably damaging 1.00
IGL01689:Cd244 APN 1 171582894 intron probably benign
IGL02327:Cd244 APN 1 171559341 missense probably benign 0.36
R0022:Cd244 UTSW 1 171573762 missense probably benign 0.03
R0930:Cd244 UTSW 1 171577233 splice site probably null
R1055:Cd244 UTSW 1 171577276 missense probably damaging 0.99
R4587:Cd244 UTSW 1 171577879 missense probably benign 0.05
R5517:Cd244 UTSW 1 171577974 splice site probably benign
R5996:Cd244 UTSW 1 171581640 splice site probably null
R6346:Cd244 UTSW 1 171577321 missense probably damaging 1.00
R6502:Cd244 UTSW 1 171577879 missense probably benign 0.05
R6612:Cd244 UTSW 1 171574104 missense probably benign 0.05
R6701:Cd244 UTSW 1 171574155 missense possibly damaging 0.67
R6973:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R7655:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7656:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7672:Cd244 UTSW 1 171577285 missense probably benign 0.28
R7769:Cd244 UTSW 1 171577305 missense probably benign 0.24
Z1177:Cd244 UTSW 1 171574350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGGTAGCCTTGTCAGTG -3'
(R):5'- TAAGGACCTGGACCACCTTCTC -3'

Sequencing Primer
(F):5'- TAGCCTTGTCAGTGCACAG -3'
(R):5'- GACCTGGACCACCTTCTCTAACC -3'
Posted On2017-02-28