Incidental Mutation 'R0563:Vstm2b'
ID46007
Institutional Source Beutler Lab
Gene Symbol Vstm2b
Ensembl Gene ENSMUSG00000039257
Gene NameV-set and transmembrane domain containing 2B
Synonyms2900093B09Rik
MMRRC Submission 038754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0563 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location40898328-40930594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40902475 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000140241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044705] [ENSMUST00000186352] [ENSMUST00000205845] [ENSMUST00000206223]
Predicted Effect probably damaging
Transcript: ENSMUST00000044705
AA Change: S115P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044002
Gene: ENSMUSG00000039257
AA Change: S115P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IG 34 149 1.84e-11 SMART
low complexity region 175 189 N/A INTRINSIC
low complexity region 202 247 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186352
AA Change: S76P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140241
Gene: ENSMUSG00000039257
AA Change: S76P

DomainStartEndE-ValueType
IG 15 110 1.7e-2 SMART
low complexity region 136 150 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189574
Predicted Effect probably damaging
Transcript: ENSMUST00000205845
AA Change: S115P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205953
Predicted Effect probably benign
Transcript: ENSMUST00000206223
Meta Mutation Damage Score 0.5734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik A G 1: 134,390,039 K183R probably benign Het
Adgrb3 G T 1: 25,547,554 P146T probably damaging Het
Ambn A C 5: 88,463,450 N163T probably benign Het
Ankrd36 A T 11: 5,629,322 E870D probably benign Het
Cdc123 T C 2: 5,798,401 N269S probably benign Het
Cdc7 A T 5: 106,972,910 probably benign Het
Cdh2 A T 18: 16,629,681 V402D possibly damaging Het
Cwc27 C A 13: 104,661,357 E365* probably null Het
Dcdc5 G A 2: 106,349,690 noncoding transcript Het
Eif4g3 T C 4: 138,175,840 probably benign Het
Elovl4 C T 9: 83,785,034 probably null Het
Fhl5 T G 4: 25,213,610 I109L probably damaging Het
Gm16181 A G 17: 35,223,896 probably benign Het
Gna14 A G 19: 16,608,119 Y287C probably benign Het
Greb1 A T 12: 16,680,267 C1720S probably benign Het
Gypa T A 8: 80,509,460 S165T probably benign Het
Hephl1 T C 9: 15,081,945 D531G probably damaging Het
Hsf2bp A T 17: 32,007,718 L221Q probably damaging Het
Itsn1 A G 16: 91,820,796 probably benign Het
Kif7 T C 7: 79,702,272 E914G probably benign Het
Lrp1b T C 2: 40,750,914 D3506G probably benign Het
Lrrc28 T C 7: 67,545,387 N225S probably damaging Het
Lysmd4 T A 7: 67,226,177 L196Q probably benign Het
Megf8 T C 7: 25,342,395 C1245R probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mindy2 T A 9: 70,631,052 I334L possibly damaging Het
Mrm1 A G 11: 84,814,713 S287P probably damaging Het
Ncor1 A G 11: 62,343,230 I382T probably damaging Het
Nectin1 A G 9: 43,791,045 T30A probably benign Het
Nelfe A G 17: 34,854,239 E250G possibly damaging Het
Nsd1 C A 13: 55,246,578 T767K possibly damaging Het
Olfr1357 G A 10: 78,612,633 P3S probably benign Het
Olfr1465 A G 19: 13,313,748 I179T probably benign Het
Olfr1507 T A 14: 52,490,257 K236* probably null Het
Olfr347 A T 2: 36,735,001 K227* probably null Het
Pcnx A G 12: 81,917,944 D295G probably damaging Het
Pex14 A G 4: 148,961,546 V309A possibly damaging Het
Phf14 C T 6: 11,933,601 probably benign Het
Pnpla6 A G 8: 3,523,333 D399G possibly damaging Het
Prim1 A G 10: 128,026,554 D340G probably damaging Het
Rb1 A G 14: 73,216,767 F564L probably damaging Het
Rcc1l G C 5: 134,176,555 R54G probably benign Het
Rnf151 G A 17: 24,717,456 probably benign Het
Rnf40 T C 7: 127,592,876 L398P probably damaging Het
Robo1 C T 16: 72,972,286 T531I probably benign Het
Rps6ka2 A T 17: 7,254,437 I198F probably damaging Het
Sgk2 T C 2: 163,004,244 L264P probably damaging Het
Slc26a6 T A 9: 108,857,670 I281N probably damaging Het
Tnxb A T 17: 34,716,947 K2657N probably benign Het
Tor1aip1 G A 1: 156,035,808 T143M probably damaging Het
Tpr A G 1: 150,408,858 D358G probably benign Het
Wdr33 A G 18: 31,886,739 K488R possibly damaging Het
Ythdc2 T A 18: 44,864,848 probably benign Het
Other mutations in Vstm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03026:Vstm2b APN 7 40902521 nonsense probably null
R0418:Vstm2b UTSW 7 40902452 missense probably damaging 1.00
R2519:Vstm2b UTSW 7 40902875 missense probably benign 0.33
R5194:Vstm2b UTSW 7 40902488 splice site probably null
R5371:Vstm2b UTSW 7 40901278 missense possibly damaging 0.84
R5436:Vstm2b UTSW 7 40901283 splice site probably null
R5580:Vstm2b UTSW 7 40902626 missense probably damaging 1.00
R5915:Vstm2b UTSW 7 40902683 missense possibly damaging 0.66
R6293:Vstm2b UTSW 7 40900109 missense probably damaging 1.00
R7048:Vstm2b UTSW 7 40929376 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGGCTGGGAAATTGGGACCCAAC -3'
(R):5'- TCTGAATGTGGGACACTGCCTCTG -3'

Sequencing Primer
(F):5'- TCTGCAACAAGGTGTCCAG -3'
(R):5'- GCAGCTTGCATGTTGGG -3'
Posted On2013-06-11