Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Sox12'

460071

Institutional Source

Beutler Lab

Gene Symbol

Sox12

Ensembl Gene

ENSMUSG00000051817

Gene Name

SRY (sex determining region Y)-box 12

Synonyms

2010205A02Rik

MMRRC Submission

044124-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5929 (G1)

Quality Score

128

Status

Validated

Chromosome

Chromosomal Location

152393611-152398063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 152397388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 104 (Y104C)

Ref Sequence

ENSEMBL: ENSMUSP00000138293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063332] [ENSMUST00000182625]

AlphaFold

Q04890

Predicted Effect

probably damaging
Transcript: ENSMUST00000063332
AA Change: Y104C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064250
Gene: ENSMUSG00000051817
AA Change: Y104C

Domain	Start	End	E-Value	Type
low complexity region	5	31	N/A	INTRINSIC
HMG	39	109	1.39e-29	SMART
low complexity region	110	182	N/A	INTRINSIC
low complexity region	191	217	N/A	INTRINSIC
low complexity region	221	250	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182625
AA Change: Y104C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138293
Gene: ENSMUSG00000051817
AA Change: Y104C

Domain	Start	End	E-Value	Type
low complexity region	5	31	N/A	INTRINSIC
HMG	39	109	1.39e-29	SMART
low complexity region	110	182	N/A	INTRINSIC
low complexity region	191	217	N/A	INTRINSIC
low complexity region	221	250	N/A	INTRINSIC

Meta Mutation Damage Score

0.6098

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SOX family of transcription factors are characterized by the presence of a DNA-binding high mobility group (HMG) domain, homologous to the HMG box of sex-determining region Y (SRY). Forming a subgroup of the HMG domain superfamily, SOX proteins have been implicated in cell fate decisions in a diverse range of developmental processes. SOX transcription factors have diverse tissue-specific expression patterns during early development and have been proposed to act as target-specific transcription factors and/or as chromatin structure regulatory elements. The protein encoded by this gene was identified as a SOX family member based on conserved domains, and its expression in various tissues suggests a role in both differentiation and maintenance of several cell types. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit no phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankib1	T	C	5: 3,769,633	I95M	possibly damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Sox12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2339:Sox12	UTSW	2	152397038	missense	possibly damaging	0.73
R2417:Sox12	UTSW	2	152396797	missense	possibly damaging	0.85
R5177:Sox12	UTSW	2	152397178	missense	unknown
R6751:Sox12	UTSW	2	152396758	missense	probably damaging	0.99
R7337:Sox12	UTSW	2	152397457	missense	probably damaging	0.98
R8319:Sox12	UTSW	2	152397272	missense	unknown
Z1088:Sox12	UTSW	2	152397465	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCCTGGACAGAAAGCCCAG -3'
(R):5'- AACGCGTTCATGGTGTGGTC -3'

Sequencing Primer
(F):5'- GTCTCCAGCAGGCGTACTTC -3'
(R):5'- TGGTGTGGTCGCAGCAC -3'

Posted On

2017-02-28