Incidental Mutation 'R5929:Plcg1'
ID460072
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationintron (38 bp from exon)
DNA Base Change (assembly) T to A at 160753602 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000109462] [ENSMUST00000151590]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect probably null
Transcript: ENSMUST00000103115
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109462
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109462
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect probably benign
Transcript: ENSMUST00000151590
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 intron probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R1978:Plcg1 UTSW 2 160752578 unclassified probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 intron probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160758097 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160753926 missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
R7777:Plcg1 UTSW 2 160754603 missense possibly damaging 0.89
Z1176:Plcg1 UTSW 2 160758127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGTTGCCAGGAGAAACC -3'
(R):5'- CTCATTCAGCTGACCCCATG -3'

Sequencing Primer
(F):5'- ATGACCTGGTCTGCTTCCACAG -3'
(R):5'- ATGCCCCTCAACAATTCTACCTC -3'
Posted On2017-02-28