Incidental Mutation 'R5929:AI481877'
ID460076
Institutional Source Beutler Lab
Gene Symbol AI481877
Ensembl Gene ENSMUSG00000038598
Gene Nameexpressed sequence AI481877
SynonymsLOC242489, Gm426
MMRRC Submission 044124-MU
Accession Numbers

Genbank: XM_001476641.2; Ensembl: ENSMUST00000107547

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59043753-59138983 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 59092497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 228 (S228*)
Ref Sequence ENSEMBL: ENSMUSP00000103171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107547]
Predicted Effect probably null
Transcript: ENSMUST00000107547
AA Change: S228*
SMART Domains Protein: ENSMUSP00000103171
Gene: ENSMUSG00000038598
AA Change: S228*

DomainStartEndE-ValueType
low complexity region 246 264 N/A INTRINSIC
low complexity region 543 560 N/A INTRINSIC
low complexity region 908 917 N/A INTRINSIC
low complexity region 1189 1201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122832
Meta Mutation Damage Score 0.9666 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
Allele List at MGI

All alleles(6) : Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in AI481877
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:AI481877 APN 4 59086961 missense probably benign
IGL00574:AI481877 APN 4 59094201 missense possibly damaging 0.66
IGL01333:AI481877 APN 4 59047870 missense possibly damaging 0.66
IGL02282:AI481877 APN 4 59111114 missense unknown
IGL02418:AI481877 APN 4 59049075 splice site probably benign
IGL02621:AI481877 APN 4 59062668 missense probably damaging 0.97
IGL03028:AI481877 APN 4 59094274 missense possibly damaging 0.66
IGL03112:AI481877 APN 4 59049355 missense probably benign 0.27
IGL03137:AI481877 APN 4 59094162 missense probably benign 0.27
IGL03220:AI481877 APN 4 59082378 nonsense probably null
IGL03386:AI481877 APN 4 59069315 missense possibly damaging 0.66
1mM(1):AI481877 UTSW 4 59048024 nonsense probably null
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0071:AI481877 UTSW 4 59059643 missense possibly damaging 0.92
R0194:AI481877 UTSW 4 59066534 splice site probably benign
R0366:AI481877 UTSW 4 59099410 missense probably benign 0.09
R0680:AI481877 UTSW 4 59043967 missense probably benign 0.00
R1419:AI481877 UTSW 4 59064457 missense possibly damaging 0.66
R1599:AI481877 UTSW 4 59072349 missense possibly damaging 0.82
R1699:AI481877 UTSW 4 59113926 missense unknown
R1799:AI481877 UTSW 4 59099383 missense possibly damaging 0.92
R1832:AI481877 UTSW 4 59066441 missense probably benign 0.05
R1870:AI481877 UTSW 4 59054142 splice site probably benign
R2076:AI481877 UTSW 4 59082410 missense possibly damaging 0.46
R2170:AI481877 UTSW 4 59069215 missense possibly damaging 0.92
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2870:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2871:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2872:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R2873:AI481877 UTSW 4 59093850 missense probably damaging 0.97
R3026:AI481877 UTSW 4 59062656 missense possibly damaging 0.83
R3079:AI481877 UTSW 4 59047848 missense possibly damaging 0.82
R3853:AI481877 UTSW 4 59047390 missense possibly damaging 0.66
R3914:AI481877 UTSW 4 59094201 missense possibly damaging 0.66
R4006:AI481877 UTSW 4 59076500 missense possibly damaging 0.53
R4364:AI481877 UTSW 4 59082294 missense possibly damaging 0.92
R4387:AI481877 UTSW 4 59060915 missense possibly damaging 0.66
R4454:AI481877 UTSW 4 59092383 missense possibly damaging 0.90
R4811:AI481877 UTSW 4 59082404 missense probably benign 0.19
R4853:AI481877 UTSW 4 59072345 missense possibly damaging 0.66
R4899:AI481877 UTSW 4 59062640 missense probably damaging 0.97
R5090:AI481877 UTSW 4 59111108 missense unknown
R5169:AI481877 UTSW 4 59059618 missense possibly damaging 0.66
R5297:AI481877 UTSW 4 59047543 missense probably benign
R5400:AI481877 UTSW 4 59082432 missense possibly damaging 0.83
R5419:AI481877 UTSW 4 59049017 missense probably benign 0.04
R5668:AI481877 UTSW 4 59047399 missense probably benign
R5770:AI481877 UTSW 4 59092466 missense probably benign 0.00
R5783:AI481877 UTSW 4 59076239 nonsense probably null
R6209:AI481877 UTSW 4 59043869 makesense probably null
R6230:AI481877 UTSW 4 59099345 missense probably benign
R6233:AI481877 UTSW 4 59076245 missense possibly damaging 0.92
R6351:AI481877 UTSW 4 59069317 missense probably benign 0.00
R6785:AI481877 UTSW 4 59049066 missense probably benign 0.01
R6884:AI481877 UTSW 4 59059652 missense possibly damaging 0.83
R7355:AI481877 UTSW 4 59076155 missense probably benign
R7423:AI481877 UTSW 4 59076264 missense probably benign 0.27
R7484:AI481877 UTSW 4 59062286 missense probably damaging 0.97
R7560:AI481877 UTSW 4 59076140 missense possibly damaging 0.66
R7999:AI481877 UTSW 4 59094162 missense probably benign 0.27
R8198:AI481877 UTSW 4 59065174 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GTAGTTTTGACAAGGAACACATTTC -3'
(R):5'- AAAGATTACTTGAGAAAGGCATTGC -3'

Sequencing Primer
(F):5'- GGAACACATTTCTAAGTGAACTCTC -3'
(R):5'- CTGTGTATAGCATTTAAGACAGA -3'
Posted On2017-02-28