Mutagenetix > Incidental Mutation

Incidental Mutation 'R5929:Ankib1'

460083

Institutional Source

Beutler Lab

Gene Symbol

Ankib1

Ensembl Gene

ENSMUSG00000040351

Gene Name

ankyrin repeat and IBR domain containing 1

Synonyms

2310061P20Rik, 4631416I11Rik

MMRRC Submission

044124-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3690000-3802925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3769633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 95 (I95M)

Ref Sequence

ENSEMBL: ENSMUSP00000040946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]

AlphaFold

Q6ZPS6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043551
AA Change: I95M

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: I95M

Domain	Start	End	E-Value	Type
ANK	45	75	7.08e-1	SMART
ANK	145	174	2.32e-5	SMART
low complexity region	209	219	N/A	INTRINSIC
low complexity region	304	319	N/A	INTRINSIC
RING	334	382	9.73e-2	SMART
IBR	403	479	8.72e-12	SMART
IBR	502	566	2.59e-5	SMART
RING	520	644	2.36e0	SMART
low complexity region	764	773	N/A	INTRINSIC
low complexity region	808	822	N/A	INTRINSIC
UIM	846	865	3.62e-1	SMART
low complexity region	905	917	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199763

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200335
AA Change: I95M

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: I95M

Domain	Start	End	E-Value	Type
ANK	45	75	4.5e-3	SMART
ANK	145	174	1.4e-7	SMART
low complexity region	209	219	N/A	INTRINSIC
low complexity region	304	319	N/A	INTRINSIC
RING	334	382	4.6e-4	SMART
IBR	403	479	2.9e-14	SMART
IBR	502	566	8.3e-8	SMART
RING	520	644	1.1e-2	SMART
low complexity region	768	779	N/A	INTRINSIC

Meta Mutation Damage Score

0.2316

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

99% (84/85)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI481877	G	T	4: 59,092,497	S228*	probably null	Het
Ang4	C	T	14: 51,764,251	C80Y	probably damaging	Het
Ankrd1	T	C	19: 36,117,877	E137G	possibly damaging	Het
Car6	T	C	4: 150,196,135	H84R	probably damaging	Het
Casd1	T	A	6: 4,629,993	L463Q	probably damaging	Het
Casz1	C	T	4: 148,938,696	S400L	probably damaging	Het
Casz1	T	A	4: 148,938,969	L491Q	probably damaging	Het
Catsperd	A	T	17: 56,652,493	H311L	probably benign	Het
Ccdc151	T	C	9: 22,002,422	E18G	possibly damaging	Het
Ccdc83	A	G	7: 90,236,316		probably benign	Het
Cd163	G	A	6: 124,326,609		probably null	Het
Cd244	A	T	1: 171,559,367	R15W	probably damaging	Het
Ces3b	A	G	8: 105,093,165	K490R	probably damaging	Het
Chordc1	T	C	9: 18,304,362	S137P	possibly damaging	Het
Col4a1	T	A	8: 11,216,788	T1140S	probably benign	Het
Col6a4	T	C	9: 106,063,044	E1229G	probably benign	Het
Cr2	A	G	1: 195,171,111	S20P	possibly damaging	Het
Dcaf13	T	A	15: 39,143,653	H327Q	possibly damaging	Het
Depdc5	G	T	5: 32,975,506	E646*	probably null	Het
Dnah5	G	A	15: 28,311,207	M1777I	probably benign	Het
Dnah5	G	T	15: 28,311,208	A1778S	probably damaging	Het
Dnajc5b	T	C	3: 19,546,855	Y39H	probably damaging	Het
Dsp	A	T	13: 38,195,434	I1453F	possibly damaging	Het
Fyn	T	A	10: 39,551,461	W447R	probably damaging	Het
Gabra6	T	A	11: 42,317,562	M148L	probably damaging	Het
Gcfc2	T	A	6: 81,946,599	V32D	probably damaging	Het
Ginm1	G	T	10: 7,774,050	L160I	probably benign	Het
Gm19345	A	G	7: 19,857,822	Y221H	probably damaging	Het
Gpr155	G	A	2: 73,373,667	R268*	probably null	Het
Hacl1	T	A	14: 31,616,388	M411L	probably benign	Het
Hdac3	C	T	18: 37,941,341		probably benign	Het
Hmcn1	C	A	1: 150,577,296	E5423*	probably null	Het
Ipo4	T	C	14: 55,631,189	H454R	probably benign	Het
Itpr1	A	T	6: 108,423,336	I1693F	probably benign	Het
Kif12	T	C	4: 63,168,517	T361A	probably damaging	Het
Kif1bp	A	T	10: 62,559,402	I487N	probably damaging	Het
Kif21b	A	G	1: 136,151,207	E431G	probably damaging	Het
Kif27	C	T	13: 58,343,970	A452T	probably benign	Het
Lhcgr	A	T	17: 88,743,008	Y363*	probably null	Het
Lrrc8d	A	T	5: 105,812,606	K294I	probably damaging	Het
Mapk3	A	C	7: 126,759,858		probably benign	Het
Mogat1	A	T	1: 78,523,733	I145F	probably benign	Het
Mtmr7	T	C	8: 40,558,358		probably null	Het
Ndufaf6	T	C	4: 11,051,150	N317D	probably benign	Het
Nfe2l1	G	T	11: 96,827,359	Q117K	probably damaging	Het
Olfm3	T	G	3: 115,101,880	I137S	probably damaging	Het
Olfr268-ps1	T	A	2: 111,844,286		noncoding transcript	Het
Otub1	G	A	19: 7,199,985	S99F	probably damaging	Het
Padi2	T	G	4: 140,944,537		probably null	Het
Paip1	C	T	13: 119,445,790	T268I	probably damaging	Het
Pak1ip1	T	C	13: 41,004,800	S50P	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phkb	A	G	8: 85,970,914	I451V	probably benign	Het
Plcg1	T	A	2: 160,753,602		probably null	Het
Prg4	A	G	1: 150,454,129	F722S	probably benign	Het
Prss3	T	C	6: 41,376,804		probably null	Het
Psmd3	C	T	11: 98,695,596	P530L	probably damaging	Het
Rims1	A	T	1: 22,468,241	D609E	probably damaging	Het
Sema3f	T	C	9: 107,692,193	Y82C	probably damaging	Het
Slc35b2	G	T	17: 45,566,661	W238L	probably benign	Het
Sox12	T	C	2: 152,397,388	Y104C	probably damaging	Het
Stx5a	T	G	19: 8,742,311	D13E	probably damaging	Het
Tlr7	C	A	X: 167,306,882	G536V	probably damaging	Het
Tspan12	A	G	6: 21,772,747	S220P	possibly damaging	Het
Utp11	T	C	4: 124,682,243	T173A	probably damaging	Het
Wrnip1	G	C	13: 32,806,966	D403H	probably damaging	Het
Xpnpep1	T	C	19: 53,013,489	T109A	probably damaging	Het
Zfp354b	A	T	11: 50,922,455	F548I	probably damaging	Het
Zufsp	A	T	10: 33,949,047	Y146*	probably null	Het

Other mutations in Ankib1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Ankib1	APN	5	3727573	missense	probably benign	0.20
IGL01329:Ankib1	APN	5	3734194	splice site	probably benign
IGL01372:Ankib1	APN	5	3772594	missense	probably damaging	1.00
IGL01593:Ankib1	APN	5	3732590	missense	probably benign	0.00
IGL01613:Ankib1	APN	5	3713146	nonsense	probably null
IGL01728:Ankib1	APN	5	3701992	splice site	probably benign
IGL01782:Ankib1	APN	5	3727607	missense	probably damaging	1.00
IGL01878:Ankib1	APN	5	3734152	missense	possibly damaging	0.69
IGL02730:Ankib1	APN	5	3702995	missense	probably damaging	1.00
IGL02742:Ankib1	APN	5	3693479	missense	probably benign	0.04
IGL02873:Ankib1	APN	5	3772619	missense	probably damaging	1.00
R0033:Ankib1	UTSW	5	3769588	missense	possibly damaging	0.52
R0242:Ankib1	UTSW	5	3700344	splice site	probably benign
R0564:Ankib1	UTSW	5	3729655	missense	probably damaging	0.99
R0632:Ankib1	UTSW	5	3772529	missense	probably benign	0.02
R0732:Ankib1	UTSW	5	3713163	missense	possibly damaging	0.89
R1678:Ankib1	UTSW	5	3706301	missense	probably damaging	0.99
R1816:Ankib1	UTSW	5	3734028	missense	probably benign	0.05
R2165:Ankib1	UTSW	5	3713210	missense	possibly damaging	0.69
R3434:Ankib1	UTSW	5	3692760	missense	probably damaging	1.00
R3749:Ankib1	UTSW	5	3734097	missense	probably damaging	0.98
R4745:Ankib1	UTSW	5	3732566	missense	probably damaging	1.00
R4827:Ankib1	UTSW	5	3701907	missense	probably damaging	1.00
R4983:Ankib1	UTSW	5	3769652	missense	probably benign	0.09
R4989:Ankib1	UTSW	5	3713217	missense	probably damaging	0.99
R5022:Ankib1	UTSW	5	3734011	missense	possibly damaging	0.96
R5057:Ankib1	UTSW	5	3734011	missense	possibly damaging	0.96
R5510:Ankib1	UTSW	5	3729693	missense	probably benign	0.02
R5606:Ankib1	UTSW	5	3701907	missense	probably damaging	1.00
R5910:Ankib1	UTSW	5	3693217	missense	probably benign
R5986:Ankib1	UTSW	5	3747071	missense	probably damaging	1.00
R6281:Ankib1	UTSW	5	3701965	missense	possibly damaging	0.70
R6336:Ankib1	UTSW	5	3700377	nonsense	probably null
R6377:Ankib1	UTSW	5	3693855	missense	possibly damaging	0.78
R7001:Ankib1	UTSW	5	3694781	missense	probably benign
R7264:Ankib1	UTSW	5	3755739	missense	probably damaging	1.00
R7380:Ankib1	UTSW	5	3722576	missense	probably benign	0.03
R7402:Ankib1	UTSW	5	3769586	missense	probably benign	0.01
R7491:Ankib1	UTSW	5	3701911	missense	probably damaging	1.00
R7525:Ankib1	UTSW	5	3755734	missense	possibly damaging	0.95
R7562:Ankib1	UTSW	5	3747021	missense	probably null	1.00
R8116:Ankib1	UTSW	5	3702995	missense	probably damaging	1.00
R8347:Ankib1	UTSW	5	3747065	missense	probably damaging	1.00
R8712:Ankib1	UTSW	5	3772643	missense	probably benign	0.03
R8750:Ankib1	UTSW	5	3702890	critical splice donor site	probably null
R8854:Ankib1	UTSW	5	3727489	missense	probably null	0.97
R9032:Ankib1	UTSW	5	3769641	missense	probably benign	0.16
R9180:Ankib1	UTSW	5	3706276	missense	probably damaging	1.00
R9325:Ankib1	UTSW	5	3772523	missense	possibly damaging	0.81
R9474:Ankib1	UTSW	5	3755617	missense	probably damaging	0.98
R9504:Ankib1	UTSW	5	3713235	missense	probably benign
R9564:Ankib1	UTSW	5	3755733	missense	possibly damaging	0.87
Z1088:Ankib1	UTSW	5	3713136	missense	probably damaging	1.00
Z1088:Ankib1	UTSW	5	3713137	nonsense	probably null
Z1176:Ankib1	UTSW	5	3692763	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TACACAGGCTTTCATCCCCG -3'
(R):5'- TGACACACCTCAATAGAAATTGGAC -3'

Sequencing Primer
(F):5'- TTTCATCCCCGAGGCTGCAG -3'
(R):5'- CACCTCAATAGAAATTGGACTTTAGC -3'

Posted On

2017-02-28