Incidental Mutation 'R5929:Lrrc8d'
ID460085
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105812606 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 294 (K294I)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
Predicted Effect probably damaging
Transcript: ENSMUST00000060531
AA Change: K294I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: K294I

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120847
AA Change: K294I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: K294I

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149831
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
BB009:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
BB019:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105826916 missense unknown
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105812489 missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
R7821:Lrrc8d UTSW 5 105812344 missense probably damaging 1.00
R7932:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
R8528:Lrrc8d UTSW 5 105812486 missense probably benign 0.22
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGAGGAGAACAAGCAGC -3'
(R):5'- TATTGTGAGTGCACTCGAACAC -3'

Sequencing Primer
(F):5'- ATAACGGGCGCCCAGAC -3'
(R):5'- GAACACCTCGTACCCCGTGAG -3'
Posted On2017-02-28