Incidental Mutation 'R5929:Gcfc2'
ID460089
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene NameGC-rich sequence DNA binding factor 2
SynonymsAW146020
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location81923669-81959915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81946599 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 32 (V32D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably damaging
Transcript: ENSMUST00000043195
AA Change: V548D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: V548D

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132301
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203959
AA Change: V32D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81936015 missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81944374 missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81957970 missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81941400 missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81949954 missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81943463 missense probably null 0.91
R0467:Gcfc2 UTSW 6 81923882 missense possibly damaging 0.56
R1105:Gcfc2 UTSW 6 81939453 missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81923812 missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81944420 missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81956892 missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81943479 missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2892:Gcfc2 UTSW 6 81956913 missense possibly damaging 0.87
R3792:Gcfc2 UTSW 6 81930767 missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81941391 missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81943007 missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81941427 nonsense probably null
R5046:Gcfc2 UTSW 6 81948335 missense probably benign 0.12
R5233:Gcfc2 UTSW 6 81953290 missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81944386 missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81943543 critical splice donor site probably null
R6339:Gcfc2 UTSW 6 81946496 missense probably damaging 1.00
R6485:Gcfc2 UTSW 6 81939547 missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81942985 missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81933753 missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81943012 critical splice donor site probably null
R7423:Gcfc2 UTSW 6 81946560 missense probably damaging 1.00
R7509:Gcfc2 UTSW 6 81953275 missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81941390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTTTGAGCCTTAGGGAAAG -3'
(R):5'- GGATGGTCGGCTCAAGAATG -3'

Sequencing Primer
(F):5'- CTCTTTGAGCCTTAGGGAAAGTCTAG -3'
(R):5'- GTCAAGTTCAAAACTCATTTCTCTGG -3'
Posted On2017-02-28