Incidental Mutation 'R5929:Itpr1'
ID 460090
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission 044124-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R5929 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108400297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1693 (I1693F)
Ref Sequence ENSEMBL: ENSMUSP00000144880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203262] [ENSMUST00000203615]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: I1693F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: I1693F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203262
SMART Domains Protein: ENSMUSP00000145177
Gene: ENSMUSG00000030102

DomainStartEndE-ValueType
low complexity region 144 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: I1693F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: I1693F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203638
Predicted Effect probably benign
Transcript: ENSMUST00000203687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205053
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 C T 14: 52,001,708 (GRCm39) C80Y probably damaging Het
Ankib1 T C 5: 3,819,633 (GRCm39) I95M possibly damaging Het
Ankrd1 T C 19: 36,095,277 (GRCm39) E137G possibly damaging Het
Car6 T C 4: 150,280,592 (GRCm39) H84R probably damaging Het
Casd1 T A 6: 4,629,993 (GRCm39) L463Q probably damaging Het
Casz1 T A 4: 149,023,426 (GRCm39) L491Q probably damaging Het
Casz1 C T 4: 149,023,153 (GRCm39) S400L probably damaging Het
Catsperd A T 17: 56,959,493 (GRCm39) H311L probably benign Het
Ccdc83 A G 7: 89,885,524 (GRCm39) probably benign Het
Cd163 G A 6: 124,303,568 (GRCm39) probably null Het
Cd244a A T 1: 171,386,935 (GRCm39) R15W probably damaging Het
Ces3b A G 8: 105,819,797 (GRCm39) K490R probably damaging Het
Chordc1 T C 9: 18,215,658 (GRCm39) S137P possibly damaging Het
Col4a1 T A 8: 11,266,788 (GRCm39) T1140S probably benign Het
Col6a4 T C 9: 105,940,243 (GRCm39) E1229G probably benign Het
Cr2 A G 1: 194,853,419 (GRCm39) S20P possibly damaging Het
Dcaf13 T A 15: 39,007,048 (GRCm39) H327Q possibly damaging Het
Depdc5 G T 5: 33,132,850 (GRCm39) E646* probably null Het
Dnah5 G A 15: 28,311,353 (GRCm39) M1777I probably benign Het
Dnah5 G T 15: 28,311,354 (GRCm39) A1778S probably damaging Het
Dnajc5b T C 3: 19,601,019 (GRCm39) Y39H probably damaging Het
Dsp A T 13: 38,379,410 (GRCm39) I1453F possibly damaging Het
Fyn T A 10: 39,427,457 (GRCm39) W447R probably damaging Het
Gabra6 T A 11: 42,208,389 (GRCm39) M148L probably damaging Het
Gcfc2 T A 6: 81,923,580 (GRCm39) V32D probably damaging Het
Ginm1 G T 10: 7,649,814 (GRCm39) L160I probably benign Het
Gm19345 A G 7: 19,591,747 (GRCm39) Y221H probably damaging Het
Gpr155 G A 2: 73,204,011 (GRCm39) R268* probably null Het
Hacl1 T A 14: 31,338,345 (GRCm39) M411L probably benign Het
Hdac3 C T 18: 38,074,394 (GRCm39) probably benign Het
Hmcn1 C A 1: 150,453,047 (GRCm39) E5423* probably null Het
Ipo4 T C 14: 55,868,646 (GRCm39) H454R probably benign Het
Kif12 T C 4: 63,086,754 (GRCm39) T361A probably damaging Het
Kif21b A G 1: 136,078,945 (GRCm39) E431G probably damaging Het
Kif27 C T 13: 58,491,784 (GRCm39) A452T probably benign Het
Kifbp A T 10: 62,395,181 (GRCm39) I487N probably damaging Het
Lhcgr A T 17: 89,050,436 (GRCm39) Y363* probably null Het
Lrrc8d A T 5: 105,960,472 (GRCm39) K294I probably damaging Het
Mapk3 A C 7: 126,359,030 (GRCm39) probably benign Het
Mogat1 A T 1: 78,500,370 (GRCm39) I145F probably benign Het
Mtmr7 T C 8: 41,011,399 (GRCm39) probably null Het
Ndufaf6 T C 4: 11,051,150 (GRCm39) N317D probably benign Het
Nfe2l1 G T 11: 96,718,185 (GRCm39) Q117K probably damaging Het
Odad3 T C 9: 21,913,718 (GRCm39) E18G possibly damaging Het
Olfm3 T G 3: 114,895,529 (GRCm39) I137S probably damaging Het
Or4f7d-ps1 T A 2: 111,674,631 (GRCm39) noncoding transcript Het
Otub1 G A 19: 7,177,350 (GRCm39) S99F probably damaging Het
Padi2 T G 4: 140,671,848 (GRCm39) probably null Het
Paip1 C T 13: 119,582,326 (GRCm39) T268I probably damaging Het
Pak1ip1 T C 13: 41,158,276 (GRCm39) S50P probably benign Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Phkb A G 8: 86,697,543 (GRCm39) I451V probably benign Het
Plcg1 T A 2: 160,595,522 (GRCm39) probably null Het
Prg4 A G 1: 150,329,880 (GRCm39) F722S probably benign Het
Prss3 T C 6: 41,353,738 (GRCm39) probably null Het
Psmd3 C T 11: 98,586,422 (GRCm39) P530L probably damaging Het
Rims1 A T 1: 22,507,322 (GRCm39) D609E probably damaging Het
Sema3f T C 9: 107,569,392 (GRCm39) Y82C probably damaging Het
Shoc1 G T 4: 59,092,497 (GRCm39) S228* probably null Het
Slc35b2 G T 17: 45,877,587 (GRCm39) W238L probably benign Het
Sox12 T C 2: 152,239,308 (GRCm39) Y104C probably damaging Het
Stx5a T G 19: 8,719,675 (GRCm39) D13E probably damaging Het
Tlr7 C A X: 166,089,878 (GRCm39) G536V probably damaging Het
Tspan12 A G 6: 21,772,746 (GRCm39) S220P possibly damaging Het
Utp11 T C 4: 124,576,036 (GRCm39) T173A probably damaging Het
Wrnip1 G C 13: 32,990,949 (GRCm39) D403H probably damaging Het
Xpnpep1 T C 19: 53,001,920 (GRCm39) T109A probably damaging Het
Zfp354b A T 11: 50,813,282 (GRCm39) F548I probably damaging Het
Zup1 A T 10: 33,825,043 (GRCm39) Y146* probably null Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,366,498 (GRCm39) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6838:Itpr1 UTSW 6 108,448,152 (GRCm39) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,415,292 (GRCm39) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,378,311 (GRCm39) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCAGTGTCCTCAGTAC -3'
(R):5'- CTGGAGAGAACTGCTAATACAGAC -3'

Sequencing Primer
(F):5'- TGGCAGTGTCCTCAGTACGTAAAC -3'
(R):5'- CTGCTAATACAGACAGGACCGG -3'
Posted On 2017-02-28