Incidental Mutation 'R5929:Mtmr7'
ID460095
Institutional Source Beutler Lab
Gene Symbol Mtmr7
Ensembl Gene ENSMUSG00000039431
Gene Namemyotubularin related protein 7
Synonyms
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40551095-40634797 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 40558358 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048890] [ENSMUST00000048890] [ENSMUST00000048898] [ENSMUST00000048898] [ENSMUST00000173487] [ENSMUST00000173487] [ENSMUST00000173487] [ENSMUST00000173487] [ENSMUST00000174205] [ENSMUST00000174205] [ENSMUST00000174205] [ENSMUST00000174205]
Predicted Effect probably benign
Transcript: ENSMUST00000048890
SMART Domains Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 4.9e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048890
SMART Domains Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 4.9e-145 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000048898
SMART Domains Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 109 448 1.6e-143 PFAM
coiled coil region 514 553 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000048898
SMART Domains Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 109 448 1.6e-143 PFAM
coiled coil region 514 553 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173487
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173487
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173487
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173487
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174205
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174205
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174205
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174205
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc151 T C 9: 22,002,422 E18G possibly damaging Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Mtmr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Mtmr7 APN 8 40597345 missense probably damaging 1.00
IGL01340:Mtmr7 APN 8 40597422 missense probably damaging 1.00
IGL01773:Mtmr7 APN 8 40581419 missense probably damaging 1.00
IGL02040:Mtmr7 APN 8 40560885 missense probably benign 0.01
IGL02195:Mtmr7 APN 8 40560905 missense probably damaging 0.96
IGL03394:Mtmr7 APN 8 40608929 missense probably damaging 0.97
R0116:Mtmr7 UTSW 8 40581405 splice site probably benign
R0379:Mtmr7 UTSW 8 40551601 missense probably damaging 1.00
R1443:Mtmr7 UTSW 8 40560882 missense probably damaging 1.00
R1763:Mtmr7 UTSW 8 40551811 missense probably benign
R4372:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R4482:Mtmr7 UTSW 8 40554384 missense probably benign 0.32
R4502:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R4622:Mtmr7 UTSW 8 40581541 missense probably damaging 1.00
R4833:Mtmr7 UTSW 8 40590462 missense probably damaging 1.00
R4849:Mtmr7 UTSW 8 40608997 missense probably benign 0.00
R4991:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R5424:Mtmr7 UTSW 8 40606830 missense probably benign
R5707:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R5985:Mtmr7 UTSW 8 40551832 missense probably benign
R6013:Mtmr7 UTSW 8 40581528 missense probably damaging 1.00
R6249:Mtmr7 UTSW 8 40581482 missense probably damaging 1.00
R7052:Mtmr7 UTSW 8 40555833 missense possibly damaging 0.83
R7249:Mtmr7 UTSW 8 40590477 missense probably benign 0.11
R7538:Mtmr7 UTSW 8 40597384 missense probably damaging 1.00
R7698:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7699:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7700:Mtmr7 UTSW 8 40606884 missense possibly damaging 0.62
R7708:Mtmr7 UTSW 8 40590511 missense probably damaging 0.98
R7890:Mtmr7 UTSW 8 40551735 missense possibly damaging 0.91
R7973:Mtmr7 UTSW 8 40551735 missense possibly damaging 0.91
R8059:Mtmr7 UTSW 8 40581522 missense probably damaging 1.00
Z1177:Mtmr7 UTSW 8 40597379 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACACAGGAAGTTCCCAAACTGG -3'
(R):5'- TGTTCAGGAAAAGCTTTCTGTCTC -3'

Sequencing Primer
(F):5'- TTCCCAAACTGGCAGGAATAAACATG -3'
(R):5'- GGAAAAGCTTTCTGTCTCACATATTC -3'
Posted On2017-02-28