Incidental Mutation 'R5929:Ccdc151'
ID460099
Institutional Source Beutler Lab
Gene Symbol Ccdc151
Ensembl Gene ENSMUSG00000039632
Gene Namecoiled-coil domain containing 151
Synonyms
MMRRC Submission 044124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5929 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21989871-22002634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22002422 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 18 (E18G)
Ref Sequence ENSEMBL: ENSMUSP00000110993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000044926] [ENSMUST00000115331] [ENSMUST00000115336] [ENSMUST00000215795] [ENSMUST00000216344]
Predicted Effect probably benign
Transcript: ENSMUST00000003493
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000044926
AA Change: E18G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041117
Gene: ENSMUSG00000039632
AA Change: E18G

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
coiled coil region 378 420 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115331
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115336
AA Change: E18G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110993
Gene: ENSMUSG00000039632
AA Change: E18G

DomainStartEndE-ValueType
coiled coil region 88 286 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
coiled coil region 379 421 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 551 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214565
Predicted Effect probably benign
Transcript: ENSMUST00000215795
Predicted Effect probably benign
Transcript: ENSMUST00000216344
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing coiled-coil domains. The encoded protein functions in outer dynein arm assembly and is required for motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mico homozygous for an ENU-induced allele exhibit dextrocardia associated with situs inversus totalis and hypoplastic spleen, adrenal anomalies and immotile/dyskinetic tracheal airway cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 G T 4: 59,092,497 S228* probably null Het
Ang4 C T 14: 51,764,251 C80Y probably damaging Het
Ankib1 T C 5: 3,769,633 I95M possibly damaging Het
Ankrd1 T C 19: 36,117,877 E137G possibly damaging Het
Car6 T C 4: 150,196,135 H84R probably damaging Het
Casd1 T A 6: 4,629,993 L463Q probably damaging Het
Casz1 C T 4: 148,938,696 S400L probably damaging Het
Casz1 T A 4: 148,938,969 L491Q probably damaging Het
Catsperd A T 17: 56,652,493 H311L probably benign Het
Ccdc83 A G 7: 90,236,316 probably benign Het
Cd163 G A 6: 124,326,609 probably null Het
Cd244 A T 1: 171,559,367 R15W probably damaging Het
Ces3b A G 8: 105,093,165 K490R probably damaging Het
Chordc1 T C 9: 18,304,362 S137P possibly damaging Het
Col4a1 T A 8: 11,216,788 T1140S probably benign Het
Col6a4 T C 9: 106,063,044 E1229G probably benign Het
Cr2 A G 1: 195,171,111 S20P possibly damaging Het
Dcaf13 T A 15: 39,143,653 H327Q possibly damaging Het
Depdc5 G T 5: 32,975,506 E646* probably null Het
Dnah5 G A 15: 28,311,207 M1777I probably benign Het
Dnah5 G T 15: 28,311,208 A1778S probably damaging Het
Dnajc5b T C 3: 19,546,855 Y39H probably damaging Het
Dsp A T 13: 38,195,434 I1453F possibly damaging Het
Fyn T A 10: 39,551,461 W447R probably damaging Het
Gabra6 T A 11: 42,317,562 M148L probably damaging Het
Gcfc2 T A 6: 81,946,599 V32D probably damaging Het
Ginm1 G T 10: 7,774,050 L160I probably benign Het
Gm19345 A G 7: 19,857,822 Y221H probably damaging Het
Gpr155 G A 2: 73,373,667 R268* probably null Het
Hacl1 T A 14: 31,616,388 M411L probably benign Het
Hdac3 C T 18: 37,941,341 probably benign Het
Hmcn1 C A 1: 150,577,296 E5423* probably null Het
Ipo4 T C 14: 55,631,189 H454R probably benign Het
Itpr1 A T 6: 108,423,336 I1693F probably benign Het
Kif12 T C 4: 63,168,517 T361A probably damaging Het
Kif1bp A T 10: 62,559,402 I487N probably damaging Het
Kif21b A G 1: 136,151,207 E431G probably damaging Het
Kif27 C T 13: 58,343,970 A452T probably benign Het
Lhcgr A T 17: 88,743,008 Y363* probably null Het
Lrrc8d A T 5: 105,812,606 K294I probably damaging Het
Mapk3 A C 7: 126,759,858 probably benign Het
Mogat1 A T 1: 78,523,733 I145F probably benign Het
Mtmr7 T C 8: 40,558,358 probably null Het
Ndufaf6 T C 4: 11,051,150 N317D probably benign Het
Nfe2l1 G T 11: 96,827,359 Q117K probably damaging Het
Olfm3 T G 3: 115,101,880 I137S probably damaging Het
Olfr268-ps1 T A 2: 111,844,286 noncoding transcript Het
Otub1 G A 19: 7,199,985 S99F probably damaging Het
Padi2 T G 4: 140,944,537 probably null Het
Paip1 C T 13: 119,445,790 T268I probably damaging Het
Pak1ip1 T C 13: 41,004,800 S50P probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phkb A G 8: 85,970,914 I451V probably benign Het
Plcg1 T A 2: 160,753,602 probably null Het
Prg4 A G 1: 150,454,129 F722S probably benign Het
Prss3 T C 6: 41,376,804 probably null Het
Psmd3 C T 11: 98,695,596 P530L probably damaging Het
Rims1 A T 1: 22,468,241 D609E probably damaging Het
Sema3f T C 9: 107,692,193 Y82C probably damaging Het
Slc35b2 G T 17: 45,566,661 W238L probably benign Het
Sox12 T C 2: 152,397,388 Y104C probably damaging Het
Stx5a T G 19: 8,742,311 D13E probably damaging Het
Tlr7 C A X: 167,306,882 G536V probably damaging Het
Tspan12 A G 6: 21,772,747 S220P possibly damaging Het
Utp11 T C 4: 124,682,243 T173A probably damaging Het
Wrnip1 G C 13: 32,806,966 D403H probably damaging Het
Xpnpep1 T C 19: 53,013,489 T109A probably damaging Het
Zfp354b A T 11: 50,922,455 F548I probably damaging Het
Zufsp A T 10: 33,949,047 Y146* probably null Het
Other mutations in Ccdc151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ccdc151 APN 9 21995379 critical splice acceptor site probably null
IGL01922:Ccdc151 APN 9 21993530 unclassified probably benign
IGL02223:Ccdc151 APN 9 21993612 missense probably damaging 1.00
IGL03161:Ccdc151 APN 9 22002315 missense probably benign 0.02
IGL03269:Ccdc151 APN 9 21998043 critical splice donor site probably null
R0118:Ccdc151 UTSW 9 21995057 missense probably benign 0.03
R0129:Ccdc151 UTSW 9 21993552 missense probably damaging 0.98
R0279:Ccdc151 UTSW 9 21990247 unclassified probably benign
R0390:Ccdc151 UTSW 9 21991708 missense probably benign 0.00
R1349:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1372:Ccdc151 UTSW 9 21993620 missense probably damaging 1.00
R1891:Ccdc151 UTSW 9 21995381 splice site probably null
R2044:Ccdc151 UTSW 9 21991858 missense possibly damaging 0.95
R5116:Ccdc151 UTSW 9 21990128 makesense probably null
R5147:Ccdc151 UTSW 9 21994862 missense probably benign 0.21
R6182:Ccdc151 UTSW 9 21990402 missense probably damaging 1.00
R7253:Ccdc151 UTSW 9 22002471 missense probably damaging 1.00
R7498:Ccdc151 UTSW 9 22002257 missense probably damaging 1.00
R7742:Ccdc151 UTSW 9 21992897 missense possibly damaging 0.82
Z1176:Ccdc151 UTSW 9 21990424 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCTGCAGCCATACTTACCTAAC -3'
(R):5'- ACTTAGCAACCGGGAGATGC -3'

Sequencing Primer
(F):5'- TGCAGCCATACTTACCTAACAGTTGG -3'
(R):5'- ATGCTAAGAGGCCCGCAG -3'
Posted On2017-02-28